StemCell Therapy

MELBOURNE, Australia--(BUSINESS WIRE)--Propanc Biopharma, Inc. (OTCQB: PPCB) (Propanc or the Company), a biopharmaceutical company developing novel cancer treatments for patients suffering from recurring and metastatic cancer, announced today that the Company appointed Ms. Belen Toledo MSc., a biotechnologist specializing in cell regenerative medicine, to evaluate the impact of proenzyme therapy on the tumor microenvironment. Ms. Toledos work will be part of the Proenzymes Optimization Project 1 (POP1) Joint Research and Drug Discovery Program designed to produce synthetic recombinant, commercial scale quantities of the two proenzymes trypsinogen and chymotrypsinogen.

Ms. Toledo, will elucidate molecular pathways involved in the proenzymes anti-tumor efficacy and study how they interact with the pre-metastatic tumor niche, focusing on the interaction and suppression of tumor associated cells, like cancer-associated fibroblasts and macrophages. A pre-metastatic tumor niche is an environment in a secondary organ conducive to the metastasis (spreading) of a primary tumor. Such a niche provides favorable conditions for growth, and eventually metastasis, in an otherwise foreign and hostile environment for the primary tumor cells. Metastasis remains the main cause of patient death from solid tumors for cancer sufferers. To achieve this, Ms. Toledo will use integrated tumor models in a microfluidics chip by obtaining 3-dimensional bio-impressions of tumor cells from patients with advanced solid tumors, developed at the Centre for Biomedical Research, University of Granada, Granada, Spain, led by Prof. Juan Marchal M.D.

Belen Toledo is a very capable biotechnologist who is excited about the project and its potential as a novel approach for the prevention and treatment of metastatic cancer. We look forward to exploring the potential of proenzyme therapy, which is groundbreaking research, said Prof. Macarena Pern, Ph.D., Lecturer and Joint Research Supervisor from Jan University.

The application of 3D tumor models on-a-chip will allow us to faithfully recreate tumor heterogeneity and stroma-tumor interactions. We aim to evaluate the effect of proenzyme therapy on effective personalized therapy models, generated from a small biopsy of patients, said Prof. Juan Antonio Marchal M.D., Joint Research Supervisor from Granada University.

Evaluating the effects of proenzyme therapy in the tumor microenvironment is critically important, as it tells us the drug is able to penetrate into this target area and exert its effects. At the same time, it confirms the selectivity of the drug on solid tumors, by targeting cancer cells and leaving healthy cells alone. The scientific implications provide us with confidence that our drug is effective and less toxic compared to standard treatment approaches, said Dr. Julian Kenyon M.D., Propancs Chief Scientific Officer and Joint Research Supervisor.

The POP1 program is designed to produce a backup clinical compound to the Companys lead product candidate, PRP. The objective is to produce large quantities of trypsinogen and chymotrypsinogen for commercial use that exhibits minimal variation between lots and without sourcing the proenzymes from animals. Propanc is undertaking the challenging research project in collaboration with the Universities of Jan and Granada, led by research scientists Mr. Aitor Gonzlez MSc. and Ms. Toledo, supported by Profs. Pern and Marchal, representing the Universities and Dr. Kenyon.

About Propanc Biopharma, Inc.

Propanc Biopharma, Inc. (the Company) is developing a novel approach to prevent recurrence and metastasis of solid tumors by using pancreatic proenzymes that target and eradicate cancer stem cells in patients suffering from pancreatic, ovarian and colorectal cancers. For more information, please visit http://www.propanc.com.

The Companys novel proenzyme therapy is based on the science that enzymes stimulate biological reactions in the body, especially enzymes secreted by the pancreas. These pancreatic enzymes could represent the bodys primary defense against cancer.

To view the Companys Mechanism of Action video on its anti-cancer lead product candidate, PRP, please click on the following link: http://www.propanc.com/news-media/video

Forward-Looking Statements

All statements other than statements of historical facts contained in this press release are forward-looking statements, which may often, but not always, be identified by the use of such words as may, might, will, will likely result, would, should, estimate, plan, project, forecast, intend, expect, anticipate, believe, seek, continue, target or the negative of such terms or other similar expressions. These statements involve known and unknown risks, uncertainties and other factors, which may cause actual results, performance or achievements to differ materially from those expressed or implied by such statements. These factors include uncertainties as to the Companys ability to continue as a going concern absent new debt or equity financings; the Companys current reliance on substantial debt financing that it is unable to repay in cash; the Companys ability to successfully remediate material weaknesses in its internal controls; the Companys ability to reach research and development milestones as planned and within proposed budgets; the Companys ability to control costs; the Companys ability to obtain adequate new financing on reasonable terms; the Companys ability to successfully initiate and complete clinical trials and its ability to successful develop PRP, its lead product candidate; the Companys ability to obtain and maintain patent protection; the Companys ability to recruit employees and directors with accounting and finance expertise; the Companys dependence on third parties for services; the Companys dependence on key executives; the impact of government regulations, including FDA regulations; the impact of any future litigation; the availability of capital; changes in economic conditions, competition; and other risks, including, but not limited to, those described in the Companys Registration Statement on Form S-1, Amendment No. 5, filed with the U.S. Securities and Exchange Commission (the SEC) on November 3, 2020, and in the Companys other filings and submissions with the SEC. These forward-looking statements speak only as of the date hereof and the Company disclaims any obligations to update these statements except as may be required by law.

More:
Propanc Biopharma Appoints Belen Toledo to Evaluate Impact of Proenzyme Therapy on Tumor Microenvironment - Business Wire

Chrissy Suttles|Beaver County Times

BEAVER A woman charged with supplying the drugs that killed a New Brighton man goes to trial this week.

Melinda Crisci, 31, of Aliquippa, is charged in the death of 54-year-old Stephen Naim, who overdosed on a mixture of heroin and fentanyl on Christmas Eve 2019. Naim was the brother offormer Aliquippa Police Officer Jimmy Naim shot and killed on the job two decades ago.

You can imagine the impact on the family, and the emotional impact on Stephen Naim, with whats been going on for 20 years, said Beaver County District Attorney Dave Lozier, adding that Naim struggled with drug addiction.

Crisci faces one first-degree felony count of drug delivery resulting in death, two counts of possession with intent to deliver and two counts of criminal use of a communication facility.

According to a police affidavit, New Brighton Area police officers found Naim dead in his apartment on Dec. 24 two years ago, discovering several bags of heroin and fentanyl in his possession. His cause of death wasdrug poisoning.

Naims cell phone revealed a woman named Mindy, later identified to be Crisci, had likely supplied him with the deadly opioids. Police, posing as Naim, asked the woman via text message to bring $50 worth of drugs to the mans apartment. She allegedly arrived with seven bags of narcotics, including heroin and fentanyl.

In a recorded interview, Crisci told police she occasionally delivered drugs for a man referred to as Tiger in Aliquippa, and had supplied Naim with drugs a few days prior to his death.

When advised of Naims death, Crisci allegedly said its next to impossible for people to die from snorting it.

Naim graduated from Hopewell High School in 1984 and studied at the University of Pittsburgh, according to his obituary, and did consulting work for years.

Even though Steve suffered with Leukemia at an early age, which attributed to several illnesses during his lifetime, he lived it caring for others, his obituary read. Family and friends were the center of his life. Steve was a kid at heart, he treasured making the children in his life feel loved.

The Beaver County District Attorneys Office has prosecutedmore than two dozen drug delivery resulting in death cases in recent years to stem drug trafficking.

We've had about a half-dozen where weve filed the charges andpassed it off to the federal government because they have even stricter sentences than we do," Lozier said.

Criscis trial began Tuesday and is expected to conclude Friday.

Read this article:
Drug delivery death trial begins in Beaver County - The Times

Introduction

Chronic myeloid leukemia (CML) is a hematological malignancy that develops when the 9;22 translocation in a single hematopoietic stem cell (HSC) results in the expression of BCR-ABL1 tyrosine kinase fusion protein. If left untreated, CML progresses over approximately 5 years, from relatively benign chronic phase to accelerated phase, and then to fatal blast crisis. The introduction of tyrosine kinase inhibitors (TKIs) specifically targeting the BCR-ABL1 fusion protein was a breakthrough in the management of CML, leading to a significant reduction in mortality and improved 5-year survival rates. However, despite the high annual acquisition costs of all the TKIs; first-, second-, and-third line TKIs1 induce only transient responses in the 10% to 15% of CML patients diagnosed in advanced phase, suboptimal responses in approximately 30% of CML patients during chronic phase (CP) cases that experience disease progression each year during, and only 1020% chance of successful treatment discontinuation due to disease persistence.2 Among the causes of disease persistence, studies have shown that CML leukemia stem cells (LSC) play a major role in inducing therapeutic resistance and disease progression because they are able to self-renew.3,4 These LSC a rare subset of immature cells residing in the bone marrow niche are protected from the action of TKI5 because these cells are normally quiescent and the TKIs are designed to target malignant blast cells that proliferate. That is why current strategies are not able to effectively eliminate the LSC or the disease.3 In CML, LSC are primitive cells expressing CD34+ CD38- with the 9;22 translocations, or the Philadelphia chromosome (Ph).6 However, these markers cannot distinguish the cancer hematopoietic cells from normal ones. Additionally, the BCR-ABL fusion gene encodes for an intracellular tyrosine kinase protein rather than a surface protein, calling for the need to identify unique surface biomarkers for efficient targeting of this cell population with subsequent eradication of the root of the disease.

In 2010, a single biomarker, Interleukin 1 receptor accessory protein (IL1RAP), was found to be up-regulated on the cell surface of BCR-ABL+ LSC. They were able to distinguish Ph+ from Ph- LSCs using IL1RAP.7 A polyclonal anti-human IL1RAP was generated that not only targeted the LSC population but also killed normal peripheral blood mononuclear cells, indicating that this marker was not specific to the LSC.7 Another characteristic cell surface marker has been investigated; ThomsenFriedenreich antigen (TF, or CD176) a tumor-associated carbohydrate epitope. The CD176 antigen was found to be expressed on the surface of various cancer-initiating cells, such as breast carcinomas,8 colorectal carcinomas,9 several leukemias,10 and other types of cancer, but was absent from almost all normal adult cell types.11 CD176 was also found to be expressed on the surface of CD34+ hematopoietic stem cells of the K562 erythroblastic leukemia cell line; a cell line derived from a CML patient. Being strongly expressed on the surface of cancer cells and virtually absent from normal tissues, CD176 was evaluated as a suitable target for cancer biotherapy8 with the development of an anti-CD176 antibody that induced apoptosis of leukemic cells.12

Using monoclonal antibodies (mAb) as a tool for cancer therapy still has its limitations. Patients who receive mAb therapy may develop drug resistance or fail to respond to treatment owing to the multiple signaling pathways involved in the pathogenesis of cancer and other diseases.13 Targeting more than one molecule has proven to circumvent the regulation of parallel pathways and avoid resistance to the treatment.14 Bi-specific antibodies (Bis-Ab) are antibodies that can recognize two different epitopes. They can redirect specific immune cells to the tumor cells to enhance tumor eradication, enable the simultaneous blocking of two different targets that have common signaling pathways, or interact with two different cell-surface antigens instead of one with subsequent boosting of the binding specificity.13 Thus, the identification of two surface markers specific to the cancer stem cells would be useful in characterizing and targeting CML stem cells, without affecting other blood cells.

In this study, we evaluated co-expression of IL1RAP, linked to BCR-ABL+ expression, and the CD176 antigen, carried on the hematopoietic stem cell marker CD34 molecule, in CML patients. We identified PBMCs co-expressing CD34, IL1RAP, and CD176 antigens using flow cytometry, a finding that allowed for subsequent separation and targeting of such cells from normal HSCs. A bi-specific antibody (TF/RAP), was generated in order to target the IL1RAP+ and CD176+ cell population among PBMCs in patients with CML. We used a flow-cytometry assay as a cell-based assay to measure the antibody binding capability of the TF/RAP Bis-Ab to the cell surface antigens. Our TF/RAP Bis-Ab, increased targeting of the IL1RAP+ and CD176+ cell population among CML PBMCs but not corresponding normal cells, using complement-dependent cytotoxicity assay (CDC). This novel TF/RAP Bis-Ab may provide a novel strategy for the eradication of CML stem cells.

Deidentified samples of peripheral blood from healthy volunteers were obtained from Gulf Coast Regional Blood Bank (Houston, TX, USA) after signing informed consent and used as reference samples. Deidentified samples of peripheral blood mononuclear cells (PBMCs) from consented patients with CML were obtained from Oncology Research Gundersen BioBank (https://www.gundersenhealth.org/research/biobank/, La Crosse, WI, USA). While the samples were de-identified, necessary CML patient characteristics were collected (Table 1). The collection and dissemination protocols for the samples are approved by The Gundersen Human Subjects Committee/Institutional Review Board (IRB) and are in full compliance with National Cancer Institute Best Practices for Biospecimen Resources. Because the de-identified samples were received through Biobanks and not through direct intervention/interaction with a research subject, the Tulane University Human Research Protection Office was notified and this study was classified by the IRB as exempt as the study did not meet the definition of human subjects research according to US Federal policy (HHS regulations, 45 CFR part 46, subpart A, also known as the Common Rule). The study was conducted in accordance with the Declaration of Helsinki.

Table 1 CML Patients Characteristics

HEK 293FT cell line (Invitrogen # R70007) was cultured in DMEM (Life Technologies, Carlsbad, CA, USA) supplemented with 10% heat-inactivated fetal bovine serum (FBS), 100 U/mL penicillin, 100 g/mL streptomycin sulfate, and 4.0 mM L-glutamine (Gibco BRL products, Gaithersburg, MD), at 37C in a humidified 5% CO2 incubator. The KG1 cell line (ATCC #CCL-246) and transduced derivative cells were cultured in Iscoves Modified Dulbeccos Medium (Life technologies) supplemented with 20% FBS at 37C in a humidified 5% CO2 incubator. K562 cell line (ATCC# CCL-243) was maintained in RPMI-1640 (Life technologies) supplemented with 10% FBS, 100 U/mL penicillin, 100 g/mL streptomycin sulfate at 37C in a humidified 5% CO2 incubator.

The IL1RAP cDNA was PCR amplified from an expression plasmid containing Human IL-1RAcP/IL-1R3 Gene ORF cDNA (Sino biological Inc., HG10121-CM) using Clone Amp HiFi PCR Premix (Takara Bio USA, Inc.), and primers that included either a BamHI or an XhoI site (F-IL1RAP: acgggatccccaccaagcttggtaccatgac; R-IL1RAP: acgctcgagttatacatttttcaaagatg). The PCR fragment was gel extracted as above, sub-cloned into BamHI and XhoI sites in the pHRST-MPSV vector according to standard protocols and confirmed by restriction mapping and sequencing.

Transient production of lentiviral particles in adherent HEK293T was modified from previously described.15 Briefly, HEK293T cells were seeded in a T-75 flask, where we used 4.0 g of envelope plasmid pMPSV-VSV-G, 10.0 g packaging plasmid psPAX2, and 26 g transfer plasmid that has the gene of interest. In our case, the transfer plasmid is either the antibody plasmid or the control. The plasmids were mixed into 500 L 0.25 M CaCl2 (Sigma Aldrich, St. Louis, MO) and incubated at room temperature for 5 minutes, and then mixed with 500 L 2xHBS and briefly vortexed. The mixed transfection cocktail was then incubated for 3 minutes at room temperature, and added into the medium of the cells, and mixed gently to make an even distribution. After 16 hours of incubation, the medium was replaced with fresh medium and collected every 24 hours for 3 days. The conditioned medium that contained the vector virus was then pelleted for 10 minutes at 1500 g and passed through a 0.45-m filter to remove the cell debris, and then frozen at 80C for long-term storage, or used for the transduction of target cells.

Lentiviral transduction was done as previously described.1618 In brief, lentiviral supernatant was added to KG1 cells cultured in complete IMEM. After overnight incubation, the lentiviral vector was removed, and fresh media was added. After 48 hours, IL1RAP expression was demonstrated by flow cytometry using anti-Human IL-1 RAcP/IL-1 R3 PE-conjugated antibody (#FAB676P, R&D Systems, Minneapolis, MN).

The CH and CL constant domains in the pLM219 plasmids were amplified with 0.5 nM overlapping mutant primers (Table S1), Deep Vent Polymerase (New England Biolabs), and reaction buffer for forty cycles at 94C for 10 seconds, 60C for 45 seconds, and 72C for 2 minutes. Initial fragments were purified, combined, and used to amplify the entire heavy or light domains (Table S2). The mutated fragments were then gel purified and sub-cloned into their corresponding vectors using restriction enzymes according to standard protocols (Table S2). Sequences were then verified by restriction digestion and sequencing.

For antibody sequences towards CD176 (TF) and IL1RAP, the VH and VL domains from two clones with the most conserved amino acid sequences (TF Clone 1 and Clone 2 called TF1 and TF2 for CD176; Clone 4B6 and Clone 4G9 called RAPa and RAPb for IL1RAP, respectively) were chosen from published sequences.20,21 IL1RAP antibody was designed to target the extracellular membrane anchor-proximal region that comprises an amino acid primary sequence VPAPRYTVELAC within 10 to 15 amino acids of amino acid 361 of human ILR1AP (Gene bank accession Q9NPH3) while the TF antibody was designed to target the same Gal(13)GalNAc disaccharide epitope20 as the Bis-Ab. Variable domains (VD) were codon-optimized and synthesized (Gene Art, Invitrogen) to be compatible with 15 base pairs of homologous sequences on both the 3 and 5 ends of pLM2 recipient plasmid flanking the EcoRI restriction enzyme site.

The pLM2 expression vector was digested with EcoRI to generate a double-stranded break. An In-Fusion HD cloning kit (Clontech, Inc) was used to clone the VD regions of the antibodies between the leader and constant regions of the pLM2 vectors. The correct clones were identified by PCR and restriction mapping and then verified by sequencing.

Adherent HEK cells were transfected as above. A total of 14 g high-quality plasmid-DNA, 10% GFP plasmid for assessment of transfection efficiency, while the rest was heavy and light chain plasmid DNA combined at a ratio of 1:1. Six to 8 hours later, cells were gently washed once with PBS and fresh growth medium added. Sixteen hours post-transfection, the medium was replaced with DMEM supplemented with 5% FCS and incubated at 5% CO2 for 24 hours prior to the initial collection of antibody supernatant. A second collection was made after a further 24 hours.

Flow antibodies used were as follows: anti-TF/CD176 mAb mouse IgM (Glycotope, Berlin, Germany) targeting Gal1-3GalNAc epitope; FITC-conjugated anti-mouse IgM secondary antibody (-chain specific, #F9259; Sigma); PE-conjugated mouse anti-human IL-1 RAcP/IL-1 R3 monoclonal IgG1 antibody, epitope Ser21-Glu359 (#FAB676P, R&D Systems); APC-conjugated mouse anti-human CD34 monoclonal IgG1 antibody (#QBEnd10, FAB7227A-025, R&D Systems); APC-conjugated mouse antihuman IgG monoclonal antibody (Clone G18-145, mouse IgG1 , #550,931, BD Pharmingen).

LIVE/DEAD Fixable Aqua Dead Cell Stain Kit (#L34957, Invitrogen); Vibrio Cholera Neuraminidase (VCN; Sigma Aldrich Inc), an enzyme used to expose the CD176 on the surface of expressing cells. Flow cytometric analyses were performed in a BD LSR Fortessa (BD Biosciences, USA) and flow cytometric cell sorting was done in a FACSAriaII (P0010) cell sorter (BD Biosciences, USA). The amount of bi-specific antibody bound to the receptors was calculated from the frequency of total IgG bound receptors.

Sorted cells were received in RPMI media and then fixed using the standard 3:1 methanol: acetic acid fixative. Standard procedures were used for FISH hybridization and washing.22 The BCR/ABL1 Plus translocation, dual fusion probe set (Cytocell Inc., Tarrytown, NY) was used. Slides were analyzed using Leica Biosystems Cyto Vision. FISH nomenclature was described according to the ISCN 2016.23

CD34+CD176+IL1RAP+ and CD34+CD176+IL1RAP- cells were sorted from PBMC samples derived from patients with CML. Cells (1 x 103) were plated in Metho Cult Express (#04437, Stem Cell Technologies, Vancouver, Canada) semi-solid media containing recombinant human IL-3, IL-6, G-CSF, GM-CSF, SCF, TPO and cultured for 2 weeks in a humidified atmosphere at 37C with 5% CO2. Fourteen days after plating, the number of colonies was counted by microscopy.24,25

The capacity to induce CDC was assessed essentially as has been described.2628 Briefly, target cells (1105 cells) were pre-incubated at 37C for 60 min with diluted antibodies. Human serum from human male AB (Sigma Aldrich) (20% v/v) was added to the cells as a source of complement and incubated at 37C for an additional 45 min. Cells were then put on ice and viability was determined by staining with LIVE/DEAD staining and detected using a FORTESSA flow cytometer (BD Biosciences). CDC activity was expressed as a percentage of lyses as determined from the increase in the percentage of cells stained positive with the LIVE/DEAD marker compared to the control samples. Cycloviolacin O2 (CyO2, 0.05nM), a pore-forming peptide, was used as a positive control because it kills cells with the similar mechanisms as CDC by causing pores in the cell membrane.

The capacity to induce CDC was assessed essentially as has been described.2628 Briefly, target cells (1105 cells) were pre-incubated at 37C for 60 min with diluted antibodies. Human serum from human male AB (Sigma Aldrich) (20% (v/v)) was added to the cells as a source of complement and incubated at 37C for an additional 45 min. Cells were then put on ice and viability was determined by staining with LIVE/DEAD staining and detected using a FORTESSA flow cytometer (BD Biosciences). CDC activity was expressed as a percentage of lyses as determined from the increase in the percentage of cells stained positive with the LIVE/DEAD marker compared to the control samples. Cycloviolacin O2 (CyO2, 0.05nM), a pore-forming peptide, was used as a positive control because it kills cells with the similar mechanisms as CDC by causing pores in the cell membrane.

We measured the production of the Bis-Ab by ELISA. Plates were initially coated with goat anti-Human IgG heavy chain antibody (Axell) and blocked with PBS containing 0.5% Tween 20 (Fisher), 10% FBS (FetalPlex Animal Serum Complex, GeminiBio, Cat#100-602), 4% whey protein (BiPRO, AGROPUR). Undiluted or diluted supernatant was added, including the standard curve samples (human IgG MAb 1.7B, kindly provided by Dr. James Robinson), and negative blocking buffer. After incubating at 37C for 60 min, the plates were washed. Then, goat anti-Human lambda antibody conjugated to HRP (Southern Biotech, Cat# 207005) was added at 1:300 in blocking buffer for 60 min and washed five times. A mixture of 0.1M Na Acetate (pH 6), peroxide, and TMB substrate were added. The reaction was terminated by adding 1M phosphoric acid, and the absorbance of each well was measured at 450 nm using a Synergy H1 microplate reader (BioTek).

For each experiment, more than three independent replicates were conducted, and the results were expressed as average standard deviation. Comparison of multiple groups was conducted using ANOVA-based Test and p< 0.05 (*) represented significances with statistical meaning. Calculation of the Kd was done using the equation % RO = [Ab]/([Ab]+Kd) 100%, where RO is the receptor occupancy, Ab is the concentration of antibody and Kd is the equilibrium dissociation constant.

In order to analyze the co-expression of CD176 and IL1RAP antigens on CD34+ cells, peripheral blood mononuclear cells from a normal volunteer (NPBMCs), patients with CML, and K562 cells were isolated and stained with anti-CD34, anti-CD176, and anti-IL1RAP monoclonal antibodies and analyzed by flow cytometry (Figure 1A). It has been previously established that these markers were not expressed on normal PBMCs nor on stem cells7,10 CD34+ cell expression ranged from an average 938% in CML samples versus 83.7% in K562 cells (Figure 1A, upper panel). Within the CD34+ cell population, CD176 and IL1RAP antigens were variably expressed in CML samples, ranging from 1.35% in CML-4 to over 50% in CML-1 (Figure 1A, lower panel), while CD176+ IL1RAP+ was detected in 78% of CD34 cells in K562 cells. Surprisingly, surface co-expression of CD176 and IL1RAP was not only detectable on CD34+ cells in patients with BCR-ABL positive CML but was also demonstrable in cells from a treated patient who was BCR-ABL negative (CML-2) (Figure 1B). In Figure 1C, CD34+ cells revealed higher frequency of CD176+ IL1RAP+ in CML group compared to control sample (17.5% versus 3.4%, p<0.001).

Figure 1 CD176 and IL1RAP antigens are co-expressed on CD34+ Leukemia stem cells. Peripheral blood mononuclear cells from patients with CML and healthy volunteers were isolated and stained for flow-cytometry analysis. (A) FACS Dot Blot showing expression of CD34 (top row) and co-expression of CD176 and IL1RAP antigens on the CD34+ cells (bottom row) in PBMCs from patients with CML compared to NPBMCs. (B) Bar graphs showing the BCR-ABL status relative to the percentage of IL1RAP and CD176 co-expression in the CD34+ subsets from patients with CML as compared to the normal control and the positive control (K562 cells). The BCR-ABL status is indicated below the sample. The error bars represent the variation in two independent experiments. (C) Average percentage of CD34+ and CD34+ CD176+ IL1RAP+ subsets in normal versus CML patients respectively. (D) Bar graphs showing the average count of colony-forming units (CFU) per 1000 CD34+CD176+IL1RAP- cells (open bar) or CD34+CD176+IL1RAP+ cells (solid bar) obtained from CML-2 and CML-4 samples. **p< 0.01, n.s represents that there is no significant difference between groups.

In order to analyze the progenitor activity of the various subpopulations, CML-2 and CML-4 were flow-sorted for CD34+CD176+IL1RAP+ and CD34+CD176+IL1RAP- then plated in media t support hematopoietic colony formation. The number of colonies, or colony-forming units (CFU), in CD34+CD176+IL1RAP+ pool represented 6% of the sorted cells with a significant difference between both populations, p<0.01 (Figure 1D and Figure S1).

To facilitate correct interaction of the VH and VL domains, site-directed mutagenesis was used to generate knob-in-hole mutations in the heavy and light chains of the constant domains (Figure 2A) via polymerase chain reaction overlap extension (Figures S2 and 3). Two PCR reactions were performed to generate two amplicons with the specific mutations included in the overlapping primers. The two fragments were then combined in a subsequent fusion reaction, in which the overlapping ends anneal, allowing the 3 overlap of each strand to serve as a primer for the 3 extension of the complementary strand. The resulting fusion product served as a template for amplification of the entire constant domain. In order to circumvent the light chain mismatching, an Orthogonal Fab interface was generated. In one Fab, complementary mutation was introduced and verified at the heavy chain constant domain (CH1_H172A_ F174G) and at the light chain constant domain (CL_L135Y_S176W), respectively (Figures S46). For the heavy chain heterodimerization, we used the Knob-in-Hole strategy, where we inserted the CH3 mutations (S354C and T366W) into different heavy chains (Figures S7 and 8). The VH and VL sequences were synthesized and cloned into the new pLM2-CH and -CL plasmids (Figure 2A) where CD176 was represented by TF1 (VH1 and VL1) and TF2 (VH2 and VL2) while IL1RAP was represented by Clone 4B6 (VHa and VLa) and Clone 4G9 (VHb and VLb). Then, we generated the four different bi-specific antibody mixtures (TF1RAPa, TF1RAPb, TF2RAPa, and TF2RAPb) to evaluate the most effective Bis-Ab (Figure 2B). The bispecific antibody was quantified by ELISA at 283 ng/mL. Since ELISA used the human IgG heavy chain antibody as the primary antibody and a goat anti-human lambda antibody conjugated to HRP as the secondary antibody, these data also confirm the correct association of the heavy and light chains and ensure that monomers are excluded.

Figure 2 The bi-specific antibody arms. (A) Schematic diagram of the bi-specific antibody showing the mutant arms and the antigen-binding domains. Thomsen-Freidenrich or CD176 domains (TF); IL1RAP domains (RAP); variable domain-heavy chain (VH); variable domain-light chain (VL); L135Y and S176W mutations (Y-W) in constant domain-light chain; H172A and F174G mutations in CH1 domain (A-G); S354C (C) or T366W (W) mutations in CH3. (B) Antibody mixtures generated by transient transfection of HEK 293T cells. TF1 and TF2 was paired with RAPa and RAPb to generate four Bis-Ab mixtures. The bispecific antibody concentration was 283 ng/mL as measured with ELISA. The correct association of the human IgG heavy chain and the lambda light chain was confirm and monomers were excluded by using anti-IgG primary antibodies and anti-light chain secondary antibodies.

KG1 cell line is an acute myeloid leukemia cell line that is known to be a positive control for CD176. For optimizing the staining protocol of CD176, KG1 cells were pre-treated with VCN to expose CD176 antigens for better staining (Figure S9). In order to test the binding capability and functional potential of our bi-specific antibody, we generated a dual-positive cell line for expressing both IL1RAP and CD176 through lentiviral transduction (Figure S10A and B). IL1RAP expression was increased by 1.5 folds in KG1/RAP cells as verified by flow cytometry (Figure S10C and D).

CD176 antigen is a glycosylated antigen; a protein antigen bound to GAL-NAC moiety which makes the antigen displayed on the cell surface yet not easy to isolate.21 For this reason, a flow-cytometry assay was used to evaluate both the binding capability and toxicity of our Bis-Ab using the gating strategy in Figure S11. KG1 and KG1/RAP cell lines were treated with the various Bis-Ab mixtures. Binding percentage was calculated from the percentage of IgG positive cells, where the secondary IgG antibody is bound to the primary Bis-Ab. The TF1RAPa Bis-Ab showed the highest binding in KG1/RAP cells (Figure 3A) as compared to other mixtures (p<0.001). In contrast, the TF1RAPb antibody revealed slightly reduced binding in KG1/RAP cells. On treating KG1/RAP cells with increasing amounts of TF1RAPa, more binding to the dual-positive KG1/RAP cells was observed (Figure 3B). To demonstrate the specificity of the Bis-Ab, we measured the competition with the CD176 and the IL1RAP monoclonal antibodies. Increasing concentrations of the Bis-Ab specifically inhibited the binding of both the IL1RAP and CD176 mAbs (Figure S12). Then, our KG1/RAP cells were treated with the Bis-Ab TF1RAPa and complement prior to staining with the LIVE/DEAD Fixable Aqua Dead Cell Stain Kit, in order to evaluate whether CDC could be achieved using IL1RAP and CD176 as targets. Flow cytometric analysis revealed a significant increase in dead cells in the Bis-Ab treated CD176/IL1RAP dual-positive KG1/RAP population as antibody binding also increased (Figure 3C), p<0.001.

Figure 3 Validation of TF-RAP Bi-specific antibody in KG1 cell line and CML samples. (A) MFI for binding of different Bis-Ab mixtures in KG1/RAP (p <0.001). (B) Binding (%) of the Bis-Ab in KG1/RAP cell lines. (C) Shows live/dead (LD) staining (%) in KG1/RAP cell lines after treatment with the Bis-Ab and complement. (D) MFI for binding of different Bis-Ab mixtures p <0.001 in CML cells. (E) Binding of the Bis-Ab (%) in PBMCs from patients with CML. The binding affinity (Kd) of our bispecific antibody was 21ng/mL, calculated using the % RO = [Ab]/([Ab]+Kd) 100%, where RO is the receptor occupancy, Ab is the concentration of antibody, and Kd is the equilibrium dissociation constant. This Bis-Ab platform used in this study had the correct molecular weight (95 KDa) and assembled properly (93%) as revealed by SDS-PAGE analysis.38 (F) Live/dead (L/D) staining (%) from patients with CML after treatment with the Bis-Ab and complement. The red square were L/D positive cells treated with CyO2; the percent of L/D staining in normal PBMCs is shown in blue. Each point represents the mean increase in L/D staining SEM with three to four replicates. Data from normal samples were low for all doses (data not shown).

Binding of TF1RAPa, TF2RAPa, and TF2RAPb was also tested in PBMCs from patients with CML. Again, TF1RAPa showed the highest binding relative to other mixtures (p<0.001) (Figure 3D) and with increasing doses (Figure 3E). Based on the CML binding curve, the binding affinity (Kd) of our bispecific antibody was 21 ng/mL. Other therapeutic antibodies, such as ofatumumab directed against CD20, have shown significant CDC against peripheral blood cells obtained from CML patients in chronic phases26 and B cells in CLL,29 respectively. Thus, the TF1RAPa cocktail was used to generate the doseresponse curve and to evaluate whether CDC could be achieved using both IL1RAP and CD176 as targets. The ability of the TF1RAPa cocktail was compared to human anti-IL1RAP and anti-CD176 monoclonal antibodies to induce cell death in PBMCs from patients with CML. PBMCs from CML1-4 were tested in CDC assays in parallel to cells from healthy control samples. In CML cells, the binding of TF1RAPa mediated CDC at higher levels than in normal peripheral blood mononuclear control cells, correlating with the expression level of IL1RAP and CD176, particularly at lower antibody concentrations (Figure 3F). More strikingly, among peripheral blood cells, TF1RAPa did not induce CDC of normal cells, whereas a clear dose-dependent CDC effect was observed in CML cells (Figure S13A and B). To address the selectivity of IL1RAP/CD176-targeting antibodies, we also validated the bispecific antibody cytotoxicity on the various subpopulations in peripheral blood. The dual-positive CD176+IL1RAP+ cell populations showed the highest CDC activity as compared to CD176+IL1RAP-, CD176-IL1RAP+, and CD176-IL1RAP- populations (Figure 4 and S13CF, S14).

Figure 4 Dose-response curve of TF1RAPa Bis-Ab on CDC in CML samples. A dose-response curve showing the selective killing potential of CD176+IL1RAP+ subpopulation by the TF1RAPa Bis-Ab as compared to other subpopulations in PBMCs from patients with CML. Each point represents the mean SEM of the four samples.

Targeting molecules involved in multiple pathways is proving to be one of the most reliable strategies for eradicating cancer stem cells. In this report, we present a novel bi-specific antibody, TF/RAP, capable of targeting ThomsenFriedenreich (TF, CD176) and IL1RAP antigens on CD34+ HSCs in CML and on cell lines. TF is a glycoprotein that has many domains and motifs (eg, LGALS3, Gal(1,3)GalNAc, LGalS3BP), many related to signaling pathways. It is a known marker for ongoing tumorigenesis and metastasis, as it is expressed on various cancer-initiating cells.8 Interestingly, CD34 and LGALS3 were found to be co-expressed in myeloid cells.30,31 LGALS3 and ABL1 are involved in regulating RUNX1 and the transcription of genes involved in differentiation of hematopoietic stem cells,32 especially myeloid cells33 (Figure S15) IL1RAP, on the other hand, is a member of the Toll-like receptor superfamily and is a well-known co-receptor of IL1R1.34 IL1RAP plays a role in mediating the effect of the pro-inflammatory cytokine IL-1 and is also involved in activating T cells and mast cells after mediating the signal of IL-1 cytokine.35 It has previously been characterized as a tightly related marker for BCR-ABL positive cells.7 Together, both TF and IL1RAP were related to apoptotic pathways; IL1RAP up-regulation was associated with decreased apoptosis in AML,36 and anti-CD176 antibody induced apoptosis of CD176-positive leukemic cells through multiple pathways.12 Although we did not find a direct link between IL1RAP, CD176 and leukemogenesis, previous studies have shown that each of them is separately expressed on CD34+ cells in leukemia cell lines8,10,12 and patients with CML7

Therefore, we conducted this pilot study, in order to assess the co-expression of IL1RAP and ThomsenFriedenreich (CD176) antigens on CD34+ HSCs in peripheral blood of patients with CML, using FACS gene expression analyses. Flow-drop FISH and CFU assays were used for the separation of CD34+CD176 BCR-ABL+ and BCR-ABL CML stem cells, based on IL1RAP expression.7 CFU numbers were significantly lower in CD34+CD176+IL1RAP- cells than in CD34+CD176+IL1RAP+ cells, obtained from CML-2 and CML-4 samples (Figure 1D), particularly CML-2 sample which was obtained from a patient in remission (BCR-ABL-). We found that the frequency of clonogenic hematopoietic progenitor cells was increased in the CD34+ CD176+IL1RAP+ cells in these samples. Testing the stem-cell characteristics of these two cell populations in immune-deficient mice would have been advantageous. Yet, the low numbers of sorted CML cells acquired from the CD34+CD176+ IL1RAP and IL1RAP+ cell subpopulations, alongwith the general low engrafting efficiency of chronic phase CML cells in these mice7 prevented us from successfully performing such experiments. Importantly, as IL1RAP expression was correlated with changes from chronic phase (CP) into accelerated phase (AP) and blast phase (BP)37, we also found that the level of IL1RAP/CD176 co-expressionwas increased, in our patient samples, as the disease progressed, independent of the treatment status(Table S3).

To target both TF and IL1RAP simultaneously, we developed a Bis-Ab specific for both antigens. Because antibodies are normally heterodimers of two heavy and two light chains, we modified the constant domains in the Bis-Ab to maximize the correct interactions of the four immunoglobulin chains within single cells. Here, we used the orthogonal Fab design; CH1_H172A_F174G and CL_L135Y_S176W38 to facilitate selective assembly of the Fab arms for correct dimerization of the antigen-binding domains.39 Therefore, we mutated CH1 and CL binding sites to restrict the assembly of the Fab with the correct VD pairs. The RAP VDs were cloned with the wild type Fab; and the TF VD was linked to the mutant orthogonal Fab design. Published data have shown that the component proteins of this Bis-Ab platform proper assembly were detected at 93% and the complex had a molecular weight of 95 KDa, as revealed by SDS-PAGE analysis.38 Additionally, the CH3 for each Fab was mutated with previously described knob-into-hole mutations40,41 to facilitate hetero-dimerization between the TF and the RAP heavy chains. In our study, we used ELISA to demonstrate that both the VD and Fc were properly paired. Here, because the primary antibody was anti-human VL and the secondary antibody was anti-human IgG, quantifying the Bis-Ab also demonstrated the VD-Fc interactions.

To efficiently validate the specific binding of our Bis-Ab, we generated a dual-positive cell line; KG1/RAP. KG1 cell line expresses CD176+, but IL1RAP is low or absent. Therefore, we induced IL1RAP expression in KG1 cells by lentiviral mediated-gene transfer, as previously usedin both immune42 and leukemic cells.43 In the competitive binding assay, increasing concentrations of the Bis-Ab blocked the binding of CD176 and IL1-RAP monoclonal antibodies to the KG1/RAP and KG1 parental cells, demonstrating the specific binding of the Bis-Ab. The level of CD176 expression in KG1 cell line was detected before and after VCN treatment. Increased staining of the KG1/RAP cells compared to the parental KG1 cells indicated that expression of the IL1RAP facilitates the interaction of the Bis-Ab with the target cell. This increased binding of the Bis-Ab to the KG1/RAP cells also increased their susceptibility to complement-dependent cytotoxicity (CDC). We also observed increased binding and increased CDC in the CD176+ IL1RAP+ population of the peripheralblood from patients with CML. As a pilot study and given that on average, 50% of the cells within the CD34+ subpopulation in the patients tested were dual positive for CD176 and IL1RAP antigens, in addition to the almost undetectable CDC in CD34+ cells in normal controls, our data strongly support the idea that the bi-specific antibody (TF/RAP) indeed induces CDC preferentially in CD176+ IL1RAP+ CML CD34+ cells. In generating a bi-specific antibody that targets CD176 and IL1RAP, we are unique in providing proof of concept that CML CD34+CD176+ IL1RAP+ cells can be targeted while preserving corresponding normal cells. The potential to target multiple antigens is supported by studies that demonstrated increased or synergistic CDC activity by non-cross blocking CD20 antibody combinations.44

Therapeutic antibodies are commonly administered intravenously, yet selectivity and specificity are a major concern for reduced toxicity. CD176/IL1RAP co-expression was not present in monocytes unlike the reported weak but present IL1RAP expression in monocytes.7 Both antigens were low or absent in most types of normal bone-marrow progenitor and mature cell types, suggesting that CD176/IL1RAP dual targeting antibodies are expected to show low toxicity on normal hematopoietic cells. Being strongly expressed on the surface of cancer cells and virtually absent from normal tissues, CD176 was evaluated as a potential target for cancer biotherapy with the development of anti-CD176 antibody that induced apoptosis of leukemic cells.8 Added to this, antibodies against IL1RAP were found to be capable of blocking IL-1 signaling as well as inhibiting tumor cells' growth in AML,34 CML,7 breast cancer,45 prostate cancer, breast cancer, lung cancer, colorectal cancer, melanomas, bladder cancer, brain/CNS cancer, cervical cancer, esophageal cancer, gastric cancer, head/neck cancer, kidney cancer, liver cancer, lymphomas, ovarian cancer, pancreatic cancer, and sarcomas46 especially in cancer stem cells, or (CSCs) and progenitor cells, which are responsible, directly or indirectly, for the development of a solid tumor.47 Thus, it may be thatour Bis-Ab will not only eradicate the CD176+IL1RAP+ drug-resistantCML stem cells but also may have universal therapeutic potential for preventing relapses in both solid and hematological cancers.Given that the mode of action in CDC is having the antibody direct the complement pathway to target cell killing, we suggest that this therapeutic strategy would be independent of known mechanisms of TKI resistance in CML. Thus, the concept of complement-mediated killing of IL1RAP/CD176 expressing cells may also have the potential to eradicate such cells in patients, either alone or in combination with current regimens, in order to increase their therapeutic effectiveness. And finally, expanded studies need to be performed in order to confirm the co-expression of both markers, especially in resistant and relapsed cancer patients as well as in patient-derived xenografts (PDX).

The experimental research was mostly supported by a fellowship to REE from the Egyptian Ministry of Higher Education, Cultural, and Missions Section (JS 3577). The lentiviral vectorHRST-cmvGFPand the packaging plasmids were akind gift from Richard C.Mulligan in the Harvard Gene Therapy Institute. The human IgG heavy and light chain constant genes were provided by JE Robinson (Tulane University). C Wu and SEB were supported by AI110158 and/or OD01104-51; EUA and SEB were supported by the Applied Stem Cell Laboratory.

All authors made a significant contribution to the work reported, whether that is in the conception, study design, execution, acquisition of data, analysis and interpretation, or in all these areas; took part in drafting, revising or critically reviewing the article; gave final approval of the version to be published; have agreed on the journal to which the article has been submitted; and agree to be accountable for all aspects of the work. All authors have given approval of the final version of the article; and have agreed to be accountable for all aspects of the work.

The abstract of this paper was presented at the AACR annual Meeting 2019; March 29 April3, 2019; Atlanta, GA, as a poster presentation with interim findings. The posters abstract was published in Poster Abstracts in the AACR meeting proceedings and as a supplement in the AACR Cancer Research Journal [https://cancerres.aacrjournals.org/content/79/13_Supplement/1222A].

Raghda Eldesouki reports grants from Egyptian Ministry of Higher Education. Stephen EBraun reports grants from Egyptian Ministry of Education, Alliance for Cardiovascular Research, NIAID OD01104, and Braun/McGroarty Charitable Fund, during the conduct of the study. In addition, Dr Raghda Eldesouki, Dr Stephen Braun, Dr Fouad Badr and Dr Eman Abdel-Moemen Mohammedhave apatent, PCT/EG2019/000014, pending. The authors report no other conflicts of interest in this work.

1. Marchetti M. Cost-effectiveness of kinase inhibitors for hematologic malignancies: a systematic and critical review. Expert Rev Pharmacoecon Outcomes Res. 2017;17(5):469480. doi:10.1080/14737167.2017.1366858

2. Holyoake TL, Helgason GV. Do we need more drugs for chronic myeloid leukemia? Immunol Rev. 2015;263(1):106123.

3. Zhou H, Xu R. Leukemia stem cells: the root of chronic myeloid leukemia. Protein Cell. 2015;6(6):403412.

4. Holyoake TL, Vetrie D. The chronic myeloid leukemia stem cell: stemming the tide of persistence. Blood. 2017;129(12):15951606. doi:10.1182/blood-2016-09-696013

5. Koptyra M, Falinski R, Nowicki MO, et al. BCR/ABL kinase induces self-mutagenesis via reactive oxygen species to encode imatinib resistance. Blood. 2006;108(1):319327. doi:10.1182/blood-2005-07-2815

6. Tasian SK, Bornhuser M, Rutella S. Targeting leukemia stem cells in the bone marrow niche. Biomedicines. 2018;6(1):22. doi:10.3390/biomedicines6010022

7. Jrs M, Johnels P, Hansen N, et al. Isolation and killing of candidate chronic myeloid leukemia stem cells by antibody targeting of IL-1 receptor accessory protein. Proc Natl Acad Sci U S A. 2010;107(37):1628016285. doi:10.1073/pnas.1004408107

8. Goletz S, Cao Y, Danielczyk A, Ravn P, Schoeber U, Karsten U. Thomsen-Friedenreich antigen: the hidden tumor antigen. Adv Exp Med Biol. 2003;535:147162.

9. Kurtenkov O, Innos K, Sergejev B, Klaamas K. The Thomsen-Friedenreich antigen-specific antibody signatures in patients with breast cancer. Bio Med Res Int. 2018;2018:9579828.

10. Sindrewicz P, Lian LY, Yu LG. Interaction of the onco-fetal Thomsen-Friedenreich antigen with galectins in cancer progression and metastasis. Front Oncol. 2016;6:79. doi:10.3389/fonc.2016.00079

11. Lin WM, Karsten U, Goletz S, Cheng RC, Cao Y. Expression of CD176 (Thomsen-Friedenreich antigen) on lung, breast, and liver cancer-initiating cells. Int J Exp Pathol. 2011;92(2):97105. doi:10.1111/j.1365-2613.2010.00747.x

12. Yi B, Zhang M, Schwartz-Albiez R, Cao Y. Mechanisms of the apoptosis induced by CD176 antibody in human leukemic cells. Int J Oncol. 2011;38:15651573.

13. Fan G, Wang Z, Hao M, Li J. Bi-specific antibodies and their applications. J Hematol Oncol. 2015;8:130. doi:10.1186/s13045-015-0227-0

14. Varela MA. Identification of sequences common to more than one therapeutic target to treat complex diseases: simulating the high variance in sequence interactivity evolved to modulate robust phenotypes. BMC Genom. 2015;16(1):530. doi:10.1186/s12864-015-1727-6

15. Wu C, Lu Y. High-titre retroviral vector system for efficient gene delivery into human and mouse cells of hematopoietic and lymphocytic lineages. J Gen Virol. 2010;91(8):19091918. doi:10.1099/vir.0.020255-0

16. Ge D, Zhang QS, Zabaleta J, et al. Doublecortin may play a role in defining chondrocyte phenotype. Int J Mol Sci. 2014;15(4):69416960. doi:10.3390/ijms15046941

17. Braun SE, Wong FE, Connole M, et al. Inhibition of simian/human immunodeficiency virus replication in CD4+ T cells derived from lentiviral-transduced CD34+ hematopoietic cells. Mol Ther. 2005;12(6):11571167. doi:10.1016/j.ymthe.2005.07.698

18. Braun SE, Lu XV, Wong FE, et al. Potent inhibition of simian immunodeficiency virus (SIV) replication by an SIV-based lentiviral vector expressing antisense Env. Hum Gene Ther. 2007;18(7):653664. doi:10.1089/hum.2007.003

19. Robinson JE, Hastie KM, Cross RW, et al. Most neutralizing human monoclonal antibodies target novel epitopes requiring both Lassa virus glycoprotein subunits. Nat Commun. 2016;7:11544. doi:10.1038/ncomms11544

20. Goltez S, Karasten U Cancer stem cell markers and uses thereof. WIPO, WO2011089004A1 2011 Jul 28.

21. Jiang Y, Tso J, Karsunky H. Antibodies that bind membrane-bound IL1rap. European patent EP2935334A1. 2015 Oct 28.

22. Keaglen MB, Gersen SL. Basic cytogenetics laboratory procedures. In: Gersen SL, Keagle MB, editors. The Principles of Clinical Cytogenetics. NewYork, NY: Springer NewYork; 2013:5365.

23. International Standing Committee on Human Cytogenetic Nomenclature. ISCN2016: An International System for Human Cytogenetic Nomenclature. Karger Medical and Scientific Publishers; 2016.

24. Broxmeyer HE, Etienne-Julan M, Gotoh A, et al. Hematopoietic colony formation from human growth factor-dependent TF1 cells and human cord blood myeloid progenitor cells depends on SHP2 phosphatase function. Stem Cells Dev. 2013;22(6):9981006. doi:10.1089/scd.2012.0478

25. Balduini A, Broxmeyer HE, Braun SE, Cornetta K, Lyman S. Comparative effects of retroviral mediated gene transfer into primary human stromal cells of flt3ligand, interleukin 3 and gmcsf on production of cord blood progenitor cells in longterm culture. Stem Cells. 1998;16:3749. doi:10.1002/stem.5530160807

26. Tatake RJ, Maniar HS, Chiplunkar SV, et al. Antibody-dependent cellular cytotoxicity and complement-mediated cytotoxicity on leukemic cells mediated by anti K562 monoclonal antibodies. J Clin Lab Immunol. 1990;31(2):8791.

27. Lindorfer MA, Beum PV, Taylor RP. CD20 mAb-mediated complement dependent cytotoxicity of tumor cells is enhanced by blocking the action of factor I. Antibodies. 2013;2:598616. doi:10.3390/antib2040598

28. Gerlach SL, Chander PK, Roy U, et al. The membrane-active phytopeptide. Cycloviolacin O2 simultaneously targets HIV1-infected cells and infectious viral particles to potentiate the efficacy of antiretroviral drugs. Medicines (Basel). 2019;6(1):E33. doi:10.3390/medicines6010033

29. Zen CS, Secreto CR, LaPlant BR, et al. Direct and complement dependent cytotoxicity in CLL cells from patients with high-risk early-intermediate stage chronic lymphocytic leukemia (CLL) treated with alemtuzumab and rituximab. Leuk Res. 2008;32(12):18491856. doi:10.1016/j.leukres.2008.05.014

30. Marer N. Galectin3 expression in differentiating human myeloid cells. Cell Biol Int. 2000;24:245251. doi:10.1006/cbir.1999.0501

31. Labbaye C, Testa U. The emerging role of MIR-146A in the control of hematopoiesis, immune function and cancer. J Hematol Oncol. 2012;5:13. doi:10.1186/1756-8722-5-13

32. Huang H, Woo AJ, Waldon Z, et al. A Src family kinase-Shp2 axis controls RUNX1 activity in megakaryocyte and T-lymphocyte differentiation. Genes Dev. 2012;26(14):15871601. doi:10.1101/gad.192054.112

33. Zhang HY, Jin L, Stilling GA, et al. RUNX1 and RUNX2 upregulate Galectin-3 expression in human pituitary tumors. Endocrine. 2009;35(1):101111. doi:10.1007/s12020-008-9129-z

34. gerstam H, Karlsson C, Hansen N, et al. Antibodies targeting human IL1RAP (IL1R3) show therapeutic effects in xenograft models of acute myeloid leukemia. Proc Natl Acad Sci U S A. 2015;112(34):1078610791.

35. McEntee CP, Finlay CM, Lavelle EC. Divergent roles for the IL-1 family in gastrointestinal homeostasis and inflammation. Front Immunol. 2019;10:1266.

36. Barreyro L, Will B, Bartholdy B, et al. Over expression of IL-1 receptor accessory protein in stem and progenitor cells and outcome correlation in AML and MDS. Blood. 2012;120(6):12901298. doi:10.1182/blood-2012-01-404699

37. Zhao K, Yin LL, Zhao DM, et al. IL1RAP as a surface marker for leukemia stem cells is related to a clinical phase of chronic myeloid leukemia patients. Int J Clin Exp Med. 2014;7(12):47874798.

38. Lewis SM, Wu X, Pustilnik A, et al. Generation of bi-specific IgG antibodies by structure-based design of an orthogonal Fab interface. Nat Biotechnol. 2014;32:191198. doi:10.1038/nbt.2797

39. Spidel JL, Vaessen B, Chan YY, Grasso LJ, Kline B. Rapid high-throughput cloning and stable expression of antibodies in HEK293 cells. J Immunol Methods. 2016;439:5058. doi:10.1016/j.jim.2016.09.007

40. Ridgway JB, Presta LG, Carter P. Knobs-into-holes engineering of antibody CH3 domains for heavy chain heterodimerization. Protein Eng. 1996;9:617621. doi:10.1093/protein/9.7.617

41. Atwell S, Ridgway JB, Wells JA, Carter P. Stable heterodimers from remodeling the domain interface of a homodimer using a phage display library. J Mol Biol. 1997;270:2635. doi:10.1006/jmbi.1997.1116

42. Pan H, Mostoslavsky G, Eruslanov E, Kotton DN, Kramnik I. Dual-promoter lentiviral system allows inducible expression of noxious proteins in macrophages. J Immunol Methods. 2007;329(12):3144. doi:10.1016/j.jim.2007.09.009

43. Biagi E, Bambacioni F, Gaipa G, et al. Efficient lentiviral transduction of primary human acute myelogenous and lymphoblastic leukemia cells. Haematologica. 2001;86(1):1316.

44. Melis JP, Strumane K, Ruuls SR, Beurskens FJ, Schuurman J, Parren PW. Complement in therapy and disease: regulating the complement system with antibody-based therapeutics. Mol Immunol. 2015;67:117130. doi:10.1016/j.molimm.2015.01.028

45. Liberg D, nnervik P, Riva M, Larsson L, Forsberg G, Wachenfeldt K. Antibody Blockade of IL1RAP Signaling Reduces Metastasis in a Breast Cancer Model. Annual Meeting of the American Association for Cancer: McCormick Place North/South Chicago, Illinois, USA; 2018.

46. Fioretos T, Jaras M Method of treatment of a solid tumor with interleukin-1 accessory protein antibody. United States patent US 9403906B2. 2016 Aug 02.

47. Fioretos T, Jaras M. Anti - IL1rap antibodies and their use for treating human. European patent EP2665749A1. 2013 Nov 27.

Here is the original post:
[Full text] Identification and Targeting of ThomsenFriedenreich and IL1RAP | OTT - Dove Medical Press

In order to raise awareness on blood stem cell registration and donation, Bollywood actor Sonu Sood, known for his exemplary dedication towards society, has joined hands with DKMS BMST Foundation India, a non-profit organisation dedicated to the fight against blood cancer and other blood disorders such as Thalassemia and Aplastic Anemia.

Sood has started an initiative to get tenthousand Indians registered as potential blood stem cell donors.

India ranks third highest in reported cases of hematological cancers in the world and it remains one of the leading causes of cancer-related death among children as well. With this blood cancer burden in the country, the need of the hour is to support blood cancer patients in the fight against such life-threatening disease.

After renowned celebrities like Vidya Balan and Rahul Dravid, Bollywood actor Sonu Sood has shared a video appeal to raise awareness about the cause.

In the video, the actor emphasized the importance of family and citing his own example, mentioned that he would do anything for their happiness and appealed to the people of India to support patients suffering from blood cancer and blood disorders by registering as potential blood stem cell donors.

He is known for his contributions towards society especially during the pandemic. He has helped many people reach their home during the lockdown, provided many students with internet facilities so that they can pursue online education. Now, he has taken another major step to support blood cancer and blood disorder patients.

Talking about the initiative, Bollywood actor Sonu Sood said: "I have dedicated myself to working towards the society. Not just any particular cause, but I reach out to individuals in need whether it is for a migrant labor, student or a patient. The COVID-19 pandemic has impacted everyone's life, and we should not forget that there are still lakhs of patients in India who are suffering from blood cancer or blood disorders and they need our urgent support. The easiest way you can raise hope in their lives is by registering as a potential blood stem cell donor. With this in mind, I have taken it as my duty and pledged to increase the blood stem cell donor pool of India by adding 10,000 potential stem cell donors. I thank NGOs like DKMS-BMST for working towards such a noble cause, the pain these patients go through is unimaginable and if I could bring hope to them there's nothing better than that during such difficult times."

Patrick Paul, CEO, DKMS-BMST said: "Each new registration creates a new possibility of second chance at life to blood cancer and blood disorder patients and this increase in the number of potential blood stem cell donors will give a hope to many patients looking for a match. We salute the contribution of Mr. Sonu Sood and wish that more Indians come forward to register as potential lifesavers!"

"All our lives we admire superheroes from movies and rarely get a chance to become a real one, but by registering as a potential blood stem cell donor you can get an opportunity to be someone's hero -- to literally save someone's life", added Sonu Sood.

The rest is here:
Sonu Sood pledges to support blood cancer patients, says 'I've dedicated myself to working for the society' - Indulgexpress

Newswise TAMPA, Fla. Myelodysplastic Syndromes (MDS) and acute myeloid leukemia (AML) are rare hematologic malignancies of the bone marrow. They can occur spontaneously or secondary to treatment for other cancers, so called therapy related disease, which is frequently associated with a mutation of the tumor suppressor gene TP53. Standard treatment for these patients includes hypomethylating agents such as azacitidine or decitabine but unfortunately outcomes are very poor.

Patients with TP53-mutant disease, which is roughly 10% to 20% of AML and de novo MDS cases, dont have many options for therapy with nondurable responses to standard therapy, said David Sallman, M.D., assistant member of the Malignant Hematology Department at Moffitt Cancer Center. There is clearly a need for new targeted therapies for this patient population.

Sallman is leading a national, multicenter clinical trial investigating a new therapy option for this group of patients. It builds upon the standard of care therapy, combining eprenetapopt (APR-246) with the chemotherapy azacitidine. Eprenetapopt is a first-in-class mutant p53 reactivator. It is infused in the body and induces cell death in TP53 mutant cancer cells. It also has a synergistic effect when combined with azacitidine, meaning not only do the drugs work well on their own but also together they provide an amplified response.

Results of the phase 1b/2 trial to determine the safety, recommended dose and efficacy of the combination therapy were published in the Journal of Clinical Oncology.

Fifty-five patients (40 MDS, 11 AML, 4 MDS/myeloproliferative neoplasms) with at least one TP53 mutation were treated. The overall response rate was 71% with 44% having a complete response (50% for MDS patients), meaning no sign of disease with return of normal blood cell production. The median overall survival for patients was 10.8 months. Patients who responded to treatment had significantly improved overall survival at 14.7 months. Additionally, 35% of patients were able to proceed with allogeneic stem cell transplantation with favorable outcomes versus historical outcomes in this patient population.

The data is promising and supports the current phase 3, multicenter trial, which we hope will lead to FDA approval and a new much-needed treatment option for this patient population, said Sallman.

This study was funded by Aprea Therapeutics.

About Moffitt Cancer Center Moffitt is dedicated to one lifesaving mission: to contribute to the prevention and cure of cancer. The Tampa-based facility is one of only 51 National Cancer Institute-designated Comprehensive Cancer Centers, a distinction that recognizes Moffitts scientific excellence, multidisciplinary research, and robust training and education. Moffitt is the No. 11 cancer hospital and has been nationally ranked by U.S. News & World Report since 1999. Moffitts expert nursing staff is recognized by the American Nurses Credentialing Center with Magnet status, its highest distinction. With more than 7,000 team members, Moffitt has an economic impact in the state of $2.4 billion. For more information, call 1-888-MOFFITT (1-888-663-3488), visit MOFFITT.org, and follow the momentum on Facebook, Twitter, Instagram and YouTube.

###

Continue reading here:
Investigational Combo Therapy Shows Benefit for TP53 Mutant MDS and Acute Myeloid Leukemia Patients - Newswise

VIRGINIA BEACH, Va. (WAVY) There is a continuing fight in the Virginia GeneralAssemblyto save the lives of children impacted by a deadly disease.

In December, the state rejected efforts to provide funding for the early screeningof Krabbe disease, a rareneurological condition. According to the Mayo Clinic, it impacts one in 100,000 children.Critics say thats why a Virginia Department of Health Screening Advisory Committee rejected it.

However, Delegate Jason Miyares (R), who represents House District 82, says he will not be denied.

This was a commitment I made when this first came to my attention, and I am a man of my word, and Im a big believer in let your yes be yes,your nois no. I promised them I would continue this fight until it gets across the finish line. Hopefully this time, with a budget amendment.

It was a promise made by Del. Miyares to the parents of 2 year old Nikola.

10 On Your Side has been following Nikolas journey since he was less than a year old.

In a recent visit his father, DraganGrujicic,was using a suction machine to clear Nikolas lungs. If I dont dothis,he could get pneumonia and kill him,Grujicicsaid.

There is no cure for Krabbe disease,but if detected just after birthand within amonth, andwith a blood stem-cell transplant, life can be extended for years.It has to be detected in newbornscreeningimmediatelyafter birth. If it is not detected early, Krabbe will kill by age five.

Every day, all day long, her care and medical needs are front and center, said Rachel Lebow. Her 3-year-old daughter Mila has Krabbe disease.

Kasey Feldts son Dawson died in November. We know he is in a better place, having funin heaven,and thatgives us peace.

Dawson was 15 months old.

Fourdays after Dawsons death, Kasey testified beforethe VirginiaDepartment of Healths Newborn Screening Advisory Committee that ended uprejecting newbornscreening for Krabbe disease.

Doctors actually voted against it.

Im so confused why the doctors said no, Kasey said.

Lebow was stunned by the defeat. Tobring in other doctors who opposed it and the things they said, just didnt make sense. And I dont know the reason behind it.

During 10 On Your Sides interview with Lebow, her daughter Mila had a mild seizure.Sadly,this is Milas life until she dies.

If Mila hadbeenscreenedat birth,and been able to receive stem-cell transplant and everything had gone well with that,Mila would not have all these complications, said Lebow.

Which brings us back to Del. Miyares who sponsored the Krabbe Screening Bill that wasrejected inRichmond.I wasdisappointed last year. Governor Northamopposed my legislation, and we allwere disappointedtheDepartment ofHealthwasnt willing to add this to theirearly screeninglist, he said.

Christen Crews is a Nurse Supervisor for the Virginia Newborn Screening Program at the Virginia Department of Health.

She confirmed at birth the stateexperts alreadythink its too late tobasicallysave the children.

Duke Universitys Dr.JoanneKurtzbergsays these Virginiaexperts are wrong,By doing thetransplant it slows down progression. Itprevents early problems from development, particularly those in the brain.

Dr.Kurtzbergperforms the Krabbe stem cell transplants and says 22 of her patients are living normal lives. The oldest is now 24 years old.

The early screening is already approved in eight other states.

It isa drop in the bucket in a multi-billion-dollarbudget, said Del. Miyares about the early screening funding.

Del. Miyares is determined to get that funding. Hehas submitted an amendment to the State Budget for newborn Krabbescreeningwhich,as he said,isa drop in the bucket to save newborn lives.

Last year, Del. Miyares used a budget bill to fight this battle, but during the shortened legislative session this year, hisstrategy is a budget amendment.

The estimated startup costs for screeningare$2.88million,with estimatedannual costs expected to cost less, about $2.56 million in a $67billion a year state budget.The cost for Krabbe screeningbreaks down to 1/10 of onepercent.

You find out, wow, the parents think had Ijust had this screening at birth I could have had this massive early intervention that would have not given my baby a death sentence, said Del. Miyares.

She (Mila) may be able towalk and run and dance and jump and laugh andsmile, said Lebow.

Del. Miyares sums it up this way. We are saving lives.Its worth it!I think thisiscritical in this debate and this discussion.Without a doubt, he believes it would be money well spent.

Here is the original post:
Delegate takes on Virginia Department of Health and the governor to get funds for Krabbe disease early screening - WAVY.com

THREE sisters who organised a fundraising ball in Ilkley in aid of Anthony Nolan are set to be honoured by the charity next month.

Emma Smith, and her sisters Hannah and Charlie call themselves the Hope Runners and have been shortlisted for blood cancer charitys group fundraiser of the year award.

Back for its eighth year, the award ceremony will recognise the achievements of the volunteers, fundraisers, clinical supporters and donors who help the pioneering blood cancer charity save lives. It usually takes place at the Tower of London, but this year, due to the coronavirus pandemic, there will be a digital celebration with invited supporters announcing winners in specially pre-recorded films.

Emma, 30, of Skipton, lost her husband Scott to Hodgkins Lymphoma in August 2019. Following his death, she teamed up with Hannah and Charlie to run last years virtual Virgin Money London Marathon for Anthony Nolan and have so far raised more than 20,000 - even though due to injury and the coronavirus only one of them was able to take part on the day.

Scott Smith, a 29-year-old firefighter, from Colne, discovered a lump on his neck which his GP originally thought was nothing serious, however he was later diagnosed with Hodgkins Lymphoma, a type of blood cancer.

Emma said: We were told that if you get cancer, this is the one you want to get as its so curable and easy to treat. Six months of chemotherapy and then you should be fine. Because of this we really thought everything was going to be okay, but things didnt work out that way at all.

A few days after receiving his diagnosis, Scott started chemotherapy and radiotherapy. However, he did not respond to treatment like doctors had hoped, and so the possibility of a stem cell transplant was mentioned. Despite numerous knock backs Scott approached the road ahead with positivity, bravery and dignity, never losing his infectious smile, says Emma.

He developed a hole between his oesophagus and bronchial, which was caused by the cancer and worsened by the radiotherapy which resulted in fluid directly entering his lungs and he developed pneumonia several times.

At this point we were told that we had two options, stop the radiotherapy and give Scott end of life care or they could attempt to reconstruct Scotts airways, but we were told that he could be in hospital for up to two years and chances are he wont survive. So, they gave us two choices but really there was only one, said Emma.

In April last year, Scott stopped all treatment and Emma stopped work to care for him. He sadly died four months later, aged 30.

The sisters call themselves the Hope Runners because they aim to give hope to people like Scott who died before he was able to have a stem cell transplant.

After being re-scheduled twice, last years London Marathon went ahead virtually, with participants planning their own 26 mile route.

Emma said: Running has really helped me cope since Scotts death. Weve set ourselves a big goal for fundraising and training, to give us something amazing and positive to focus on in what we know will be the hardest year. Weve seen each other through the darkest of times so I that if we can get through that together, we could get through a marathon.

Having to train for the marathon twice for in one year was really hard. On the day it was postponed in March I had just done the worst 16 mile training run and I said to my sisters this chuffing marathon better not be cancelled!

The marathon was postponed to October, so I continued to do six and eight mile runs throughout lockdown, and then started training for the marathon again in June, it was hard to motivate ourselves when we knew it might be cancelled or postponed again.

Devastatingly, Emma was unable to run the virtual marathon due to an injury and Hannah had to self-isolate due to coronavirus but Charlie was still able to complete, and despite everything, the trio have raised more than 20,000 for Anthony Nolan and now plan to run the London Marathon in 2023.

As part of their fundraising efforts, they also organised the Hope Ball, which took place at The Craiglands Hotel in Ilkley, in February last year and which was attended by around 250 people.

Emma said: We feel so very proud to have been nominated for an Anthony Nolan Supporter Award- as a family we have been through some very darks times and so it means all the more to us to have something positive come from it all.

Whether we win the award or not, it is the best feeling to know that the funds and awareness we have raised will give so many families the happy ever after that they deserve.

Henny Braund, Chief Executive of Anthony Nolan, said: It is remarkable to see how many people support our work to find a match for those in need of a stem cell transplant. Without them, none of our life-saving work would be possible.

The Hope Runners have shown tremendous commitment to Anthony Nolan by going above and beyond in their fundraising efforts, despite facing many hurdles on their journey.

All winners will be revealed at 7pm on Thursday, February 11 at http://www.anthonynolan.org/awards

Here is the original post:
Sisters who organised an Ilkley fundraising ball are to be honoured - Wharfedale Observer

January 21, 2021

Once regarded as merely cast-off waste products of cellular life, bacterial membrane vesicles (MVs) have since become an exciting new avenue of research, due to the wealth of biological information they carry to other bacteria as well as other cell types.

These tiny particles, produced by most bacteria, can bud off from outer cellular membranes, traveling along cell surfaces and occasionally migrating into intercellular spaces. Luis Cisneros is a researcher in the Biodesign Center for Biocomputing, Security and Society, and the BEYOND Center for Fundamental Concepts in Science at Arizona State University. Download Full Image

In a new study,Luis H. Cisnerosand his colleagues describe the effects of antibiotics on membrane vesicles, demonstrating that such drugs actively modify the properties of vesicle transport. Under the influence of antibiotics, MVs were produced and released by bacteria in greater abundance and traveled faster and farther from their origin.

The researchers suggest that the altered behaviors of MVs may represent a stress response to the presence of antibiotics and further, that MVs liberated from the cell membrane may transmit urgent warning signals to neighboring cells and perhaps foster antibiotic resistance.

"Its long been believed that membrane vesicles are involved in the cell-cell signaling process leading to changes in the collective behavior of living cells, like the coordination of survival responses due to antibiotic stress, Cisneros said. "But many details in the dynamics of this process are not yet well understood. Our work opens a new door in this field.

Cisneros is a researcher in theBiodesign Center for Biocomputing, Security and Society, and theBEYOND Center for Fundamental Concepts in Scienceat Arizona State University. He is joined by Julia Bos and Didier Mazel, colleagues from the Institut Pasteur, Paris.

The research findings appear in the current issue of the journalScience Advances.

Membrane vesicles encapsulated particles shed from the membranes of bacteria are conduits of information. Like nanoscale flash drives, they can encode and carry volumes of data in the form of polysaccharides, proteins, DNAs, RNAs, metabolites, enzymes and toxins. They also express many proteins on their outer membrane that are derived from the bacterial surfaces from which they were exuded.

Groundbreaking research on the mechanisms controlling vesicles traffic were awarded a Nobel Prize in physiology and medicine in 2013 and are currently being used to package the SPIKE mRNA in the long-awaited COVID-19 vaccine.

The rich storehouse of information carried by MVs and its ultimate effect on bacterial and nonbacterial cells is of great scientific and medical concern. In addition to alerting fellow bacteria of environmental stresses like antibiotics, MVs have been implicated in the quorum sensing activities that inform bacteria of overall population densities and may even affect brain processes in higher mammals. This could occur if MVs produced by gut microbes transport their cargo to the nervous system.

Membrane vesicles are common to all life kingdoms, from bacteria and other unicellular organisms to archaea and eukaryotic cells found in multicellular organisms, including cancer cells. Depending on the cell type from which they emerge, they have been implicated as vital contributors to intercellular communication, coagulation, inflammatory processes and the genesis of tumors, as well as playing a role in the biology of stem cells.

Despite their importance however, MVs have received inadequate attention until recently.Due to their diminutive nature, measuring between 20 and 400 nanometers in diameter, they are a challenging subject of study, particularly in their natural state within living systems.

Key to gaining insight into the subtle behavior of MVs hasbeen technological advances that allow them to be closely observed. The new study outlines sophisticated methods of florescence microscopy and data analysis used to track the production and transport of MVs under laboratory scrutiny.

Traditionally, MVs have been studied with the aid of biochemical techniques, electron microscopy and atomic force microscopy. These methods have helped researchers probe the contents of MVs, which may contain nucleic acids, proteins, lipids, various toxins, antibiotics, phage receptors, signaling molecules, metabolites, metals and growth factors. The precise composition of MVs is dependent on physiological details of the mother cell as well as the mode by which the MVs are formed.

Likewise, numerous factors can affect the formation and release of MVs. These include antibiotics and chemotherapy drugs, environmental influences, cell death and necrosis as well as damage to the bacteriums DNA. The heightened production and transport of MVs may be a generalized response to bacterial stress.

The downstream effects of MV transport likewise remain a topic of considerable speculation. The release of MVs appears to be involved in a number of critical biological processes including cell-cell communication, horizontal gene transfer, social phenomena and immune response modulation. Importantly, they are also believed to act as decoys for antibiotics.

To better understand these and other attributes of MVs in living systems, it is vital to closely follow their movements over time. The current study represents the first high-resolution, quantitative tracking of MVs in response to antibiotic treatment.

The experiments described involve a population of live Escherichia coli, commensal bacteria common in the human gut. The individual MVs were tagged with a fluorescent dye, then visualized using time-lapse fluorescence microscopy at high magnification combined with fast image acquisition. Additionally, MV transport was investigated with imaging tools allowing particle tracking to be fully automated.

Analysis of vesicle movement revealed that treatment with low doses of antibiotic significantly altered vesicle dynamics, vesicle-to-membrane affinity, and surface properties of the cell membranes, generally enhancing vesicle transport along the surfaces of bacterial membranes. Continuing studies should help researchers determine if populations of bacteria displaying ramped-up, stress-induced MV transport show enhanced antibiotic resistance.

According to Bos, corresponding author of the newstudy, This is the first evidence that tracking thousands of individual membrane vesicle trajectories in real time in a live population of microorganisms has been achieved. Gaining insights into how they move and locate themselves within a bacterial microcolony and how their motion properties could be a signature of antibiotic stress, will undoubtedly open a new avenue of research on this fascinating and currently hot topic.

The study helps advance our understanding of these as-yet mysterious entities while potentially paving the way for a range of applications in immunology and biotechnology.

Read the original here:
Message in a bottle: Info-rich bubbles respond to antibiotics - ASU Now

Introduction

Allogeneic hematopoietic stem cell transplantation (allo-HSCT) is a treatment process for restoring normal hematopoietic and immune functions. In this method, patients undergo high-dose radiotherapy and chemotherapy, and immunosuppressive pre-treatment is done to eliminate abnormal hematopoietic and immune systems. The patient is then transfused with allogeneic hematopoietic stem cells. This strategy is an effective cure for blood diseases, bone marrow failure syndrome, and immune deficiency.1,2 However, neutrophil deficiency, impaired mucosal barrier, and weakened immune function typically occur after transplantation, which increases the risk of infection after HSCT.3

Bloodstream infections (BSI) are a severe type of systemic infectious disease caused by the invasion of the circulatory system by pathogenic microorganisms. Notably, BSI is a common complication in the early stages of allo-HSCT and has an incidence rate of 13.6%38.9%.47 According to literature, the occurrence of bloodstream infections is a huge risk factor to early deaths after HSCT.810 The occurrence of BSI after HSCT is exacerbated by the widespread use of antibiotics and the resultant antibacterial resistance, especially multi-drug-resistant bacteria (MDR) that seriously affects the survival of transplant patients.1113 Thus, evaluation of the distribution and prevalence of drug-resistant pathogens of the bloodstream in allo-HSCT patients and the study of the BSI risk factors could guide the course of clinical treatment for BSI prevention and control. This study retrospectively analyzed the BSI risk factors in patients with allo-HSCT in the First Affiliated Hospital of Zhengzhou University from 2013 to 2017. The detection rate, distribution, and drug sensitivity of pathogenic bacteria after allo-HSCT was also evaluated.

From January 2013 to December 2017, 397 patients who received allogeneic HSCT for the treatment of hematological diseases in the First Affiliated Hospital of Zhengzhou University were selected. The patients included 242 males and 155 females, with a median age of 21 (162) years. Of these, 115 cases had acute myeloid leukemia (AML), 110 with severe aplastic anemia (SAA), 102 with acute lymphocytic leukemia (ALL), and 70 patients with other conditions.

According to the difference in the histocompatible typing and relationship, allo-HSCT is divided into matched sibling transplantation, partially matched related transplantation and matched unrelated transplantation. Among the 397 cases of allo-HSCT, 177 were matched sibling transplantation, 165 were partially matched related transplantation, and 55 were matched unrelated transplantation. According to the stem cell source, there were 333 cases of peripheral hematopoietic origin, 55 from peripheral blood combined with bone marrow transplantation, and nine involved cord blood transplantation.

Central vein catheterization was performed for all patients before transplantation conditioning. Modified busulfan/cyclophosphamide (Bu/Cy) and total body irradiation/cyclophosphamide (TBI/Cy) conditioning regimens were used for patients with acute leukemia, myelodysplastic syndrome, and lymphoma. Meanwhile, cyclophosphamide + anti-thymocyte globulin (Cy-ATG) and FluCy-ATG pre-treatment regimens were used for severe aplastic anemia. The GVHD prevention program used cyclosporine combined with mycophenolate mofetil and methotrexate, of which 272 cases were also treated with ATG to prevent GVHD.

All HSCT patients were admitted to the laminar flow purification ward after a medicated bath, and were given a sterile diet, and received oral, eye, nose, and perianal care. Take a 1:2000 chlorhexidine liquid medicinal bath for 20 minutes; routinely gargle with saline and cermetium chloride before and after three meals a day, add metronidazole solution if necessary; use 1% chloramphenicol, 0.5% Rifampicin eye drops alternate eye drops, 4 times/d; alternate nose drops with houttuynia cordata and streptomycin nasal drops, 4 times/d; rinse the perineum with warm water after each bowel movement, 3% boric acid solution for a bath for 20 Minutes, mupirocin is applied to the perianal area. Itraconazole, berberine, and compound sulfamethoxazole were administered orally for intestinal disinfection two weeks before transplantation. If the body temperature of patients got to 38.00C during transplantation or shivering occurred, 10 mL of blood from the peripheral vein was collected using standard. The blood was drawn twice in a row for separate cultivation of aerobic and anaerobic bacteria. For positive cases, broad-spectrum antibiotics were administered intravenously, and the treatment efficacy was evaluated 48 hours after the initial treatment. Treatment efficacy was empirically assessed based on blood culture results, WBC, C-reactive protein, and procalcitonin levels, after which ineffective treatment strategies were adjusted.

Agranulocytosis refers to the absolute value of neutrophils <0.5 109/L,14 while granulocyte reconstitution refers to neutrophils 0.5 109/L for three consecutive days after transplantation.

Fever is a single measurement of oral temperature 38.3C (axillary temperature 38.0C) or 38.0C (axillary temperature 37.7C) for more than 1 hour.

The pathogenic diagnosis of BSI was made after the isolation of pathogenic microorganisms from blood culture. If the same patient isolates the same bacteria, if the drug sensitivity is the same, it is 1 BSI. BSI-related mortality was defined as death occurring within 30 days after the diagnosis of BSI. Pre-engraftment BSI is defined as the infection that arises from the onset of the pre-treatment regimen to the time before granulocyte implantation.

VersaTREK automatic blood culture instrument (Thermo Fisher, USA), VITEK MS IVD 3.0 mass spectrometer identification instrument and VITEK2 Compact automatic microbial identification, and drug sensitivity analysis system for bacterial culture, identification, and drug sensitivity detection, spread through paper (K-B) method and E-Test were used in in vitro susceptibility tests and review of abnormal susceptibility results. The results were interpreted according to the standards issued by the United States Committee for Clinical and Laboratory Standardization (CLSI).15

The SPSS21.0 software was used for statistical analysis, and descriptive statistics were used to summarize clinical features. The univariate analysis used a chi-square test, while logistic regression was applied for multivariate analysis. A P-value of 0.05 was used as the level of significance; thus, P<0.05 indicated statistically significant differences.

Among the 397 HSCT patients, 294 had agranulocytosis fever, out of which 52 were microbiologically confirmed as BSIs. Therefore, the incidence of BSI was 17.7% (52/294), accounting for 13.1% (52/397) of all transplant patients. The implantation time of neutrophils is 13 days (11,15), and the time from agranulocytosis to BSI is 12 days (7,30). For 294 patients, we did 607 blood cultures, among which 60 were positive (9.9% positive blood culture rate). Out of the 294 patients, six had two or more pathogenic bacteria.

Sixty pathogens were detected in 52 patients, including 43 Gram-negative bacteria (71.67%), 10 Gram-positive bacteria (16.67%), and 7 fungi (11.67%). We found that Gram-negative bacteria accounted for most BSIs, followed by Gram-positive bacteria, and fungal infections were the least. The numbers and proportions of different strains of pathogenic bacteria are shown in Figure 1. In terms of drug resistance, the extended-spectrum -lactamase (ESBL) detection rates of E. coli and K. pneumoniae were 46.7% (7/15) and 30% (3/10), respectively. Carbapenem-resistant Enterobacteriaceae (CRE) accounted for 17.9% (5/28). The recorded patterns for Gram-negative bacteria drug susceptibility are shown in Table 1. The two staphylococci detected in Gram-positive bacteria were all methicillin-resistant, and all the three enterococci were sensitive to vancomycin, teicoplanin, and linezolid. The detected fungi belong to the genus Candida, and the resistance rates to itraconazole and voriconazole were 57.1% and 28.6%, respectively.

Table 1 Resistance Rate of Major Gram-Negative Bacteria to Common Antibacterial Drugs

Figure 1 Distribution of 60 isolated pathogenic bacteria pathogen.

Out of the 52 BSI patients, 33 improved after treatment, while 19 died after treatment failed (36.5%). Among the 19, 13 had Gram-negative bacteria infection, three were Candida infections, while another three were mixed Gram-negative and Gram-positive bacterial infection. Six of the seven patients who were resistant to carbapenems died.

We divided the 294 patients with agranular fever into two groups: BSI-free (242) and BSI (52). Univariate and multivariate analyses were applied for the study of BSI risk factors, including patients age, gender, disease type, stem cell source, pre-treatment application of ATG, combined diarrhea, oral ulcers, and presence of granules. Univariate analysis results demonstrated that the occurrence of BSI was correlated to the transplantation method, pre-treatment application of ATG, agranulocytosis time (21 days), and stem cell source (Table 2). Meanwhile, multivariate analysis showed that pre-treatment application of ATG, agranulocytosis time (21 days), and stem cell source were risk factors for BSI (Table 3).

Table 2 Univariate Analysis of Risk Factors for BSI

Table 3 Multivariate Analysis of Risk Factors for BSI

Allo-HSCT patients undergo prolonged agranulocytosis and develop an impaired mucosal barrier. Besides, the long-term use of immunosuppressive agents increases the incidence of bloodstream infections.47 In the present study, the incidence of bloodstream infections was 13.1% in all patients, and 17.7% in patients with febrile neutropenia. A previous study conducted in China reported that the incidence of bloodstream infections in patients with febrile neutropenia was 17.0%.16 Thus, our findings are consistent with earlier results of other studies. The mortality rate of allo-HSCT bloodstream infections in our center was 36.5%, which is higher than the 26.9% reported by Mikulska et al17 and the 31.1% reported by Stoma et al.18 In addition, studies by Stoma et al also found that the application of fluoroquinolones can reduce the incidence of bloodstream infections by affecting the colonization of intestinal bacteria, while insufficient empirical antibacterial treatment is associated with increased mortality.18,19 This disparity suggests that we should pay attention to the prevention and treatment of bloodstream infections in transplant patients and formulate anti-infection strategies based on the distribution of pathogens and drug resistance patterns to improve transplantation and survival rates.

This study detected 60 pathogens in BSIs, of which gram-negative bacteria (71.67%) were the main ones, followed by gram-positive bacteria (16.67%), and fungi were the least (11.67%) (Figure 1). Gram-negative bacteria were mainly of the Enterobacteriaceae family, particularly E. coli and K. pneumoniae. The non-fermenting bacteria P. aeruginosa was also detected. A 25-year study in Spain showed that BSIs after HSCT were mainly caused by gram-positive bacteria, with a downward trend in positive bacteria and an increasing trend in gram-negative bacteria.20 Blennow et al also reported similar conclusions.21 However, many transplant centers in China have reported that BSIs after HSCT are mainly caused by gram-negative bacteria, followed by gram-positive bacteria, while fungi make up the least proportion. Thus, the epidemiology of BSIs in our center conforms to the distribution pattern reported in other centers in China.22,23

In this study, the common Enterobacteriaceae (E. coli and K. pneumoniae) had ESBL detection rates of 46.7% and 30%, respectively, and carbapenem resistance rates of the two bacteria were 6.7% and 30%, respectively (Table 1). Thus, we found that E. coli is highly sensitive to carbapenem drugs, suggesting that these drugs can be used for empiric antibacterial treatment. The ESBL positivity rate and carbapenem resistance rate of K. pneumoniae were both 30% (Table 1), indicating that its clinical treatment can be a combination of tigecycline, polymyxin, and other drugs. Notably, research shows that combination therapy with antibacterial medications such as cyclin and polymyxin can reduce the mortality of patients.24,25 In the present study, the resistance rate of P. aeruginosa to carbapenems was 28.6%, while its resistance rate to both aminoglycosides and quinolones was 14.3% (Table 1). Thus, a combination of carbapenems, aminoglycosides, and quinolones can be used for clinical treatment. Multi-center research in China reported carbapenem resistance rates of 3.6% and 18.9% for E. coli and K. pneumoniae, respectively.26 Similarly, this study revealed high resistance of E. coli and K. pneumoniae to carbapenem. The high rate of mycene resistance could be attributed to the repeated use of broad-spectrum antibiotics in transplant patients and the continuous increase in multi-drug-resistant bacteria in recent years.27 In response to the rise in multi-drug-resistant bacteria, our center uses perianal swabs to regularly screen intestine colonizing bacteria in transplant patients. As such, pathogenic bacteria are identified early, and treatment strategies are adjusted based on drug sensitivity results. The sensitivity of Gram-positive bacteria to the glycopeptides vancomycin, linezolid, and teicoplanin was 100.0%, suggesting that Gram-positive bacteria BSIs can be completely treated in clinical practice. Thus, glycopeptide or azole drugs can be the first choice for the treatment of Gram-positive bacteria BSIs.

All the seven fungi in this study were Candida, and Candida tropicalis was the predominant species. The resistance rates to itraconazole and voriconazole were 57.1% and 28.6%, respectively. The mortality rate of candidiasis was high, which significantly threatened the survival of transplant patients. According to previous studies, caspofungin should form the first choice fungal treatment after allo-HSCT in clinical practice, combined with antifungal treatment if necessary.28,29

The single-factor and multi-factor analysis results showed that pre-treatment application of ATG, agranulocytosis time (21 days), and stem cell source were risk factors for BSI. The removal of T-lymphocytes from the body of ATG-pretreated patients significantly delays immune reconstitution,30 and the continued lack of granulocytes causes immunodeficiency in transplant patients, thus increasing the risk to BSIs. Peripheral blood combined with bone marrow transplantation, hematopoietic implantation is relatively fast, which may be the reason for the lower incidence of BSIs in this group of patients, relative to peripheral blood and cord blood transplantation.3133

The results of this study show that BSI is a common complication of allo-HSCT patients with agranulocytosis. Gram-negative bacteria were the most prevalent pathogen in BSIs, and drug resistance to carbapenem drugs was relatively high. The use of ATG in pre-treatment, agranulocytosis time (21 days), and stem cell source are risk factors for BSI. The high mortality rate of BSI substantially affects the prognosis of transplant patients, and attention should be paid on the distribution of pathogenic bacteria and drug resistance in the bloodstream of transplant patients. Besides, the treatment plan should be adjusted based on the specific bacteria and drug resistance patterns.

The patient consent was waived, since the research involves no more than minimal risk to the subjects because the review of subjects medical records is for limited information. The information is not sensitive in nature, and the data are derived from clinically indicated procedures. The precautions taken to limit the record review to specified data and the coding of the data further minimize the primary risk, which is a breach of confidentiality. This study has been approved by the ethics review committee of the research project of the First Affiliated Hospital of Zhengzhou University, and has obtained relevant certificates.

All authors made a significant contribution to the work reported, whether that is in the conception, study design, execution, acquisition of data, analysis and interpretation, or in all these areas; took part in drafting, revising or critically reviewing the article; gave final approval of the version to be published; have agreed on the journal to which the article has been submitted; and agree to be accountable for all aspects of the work. This study complies with the Declaration of Helsinki.

This project was supported by the Key Scientific Research Project Plan of Higher Education Institutions in Henan Province (18A320040).

The authors report no conflicts of interest in this work.

1. Barriga F, Ramirez P, Wietstruck A, Rojas N. Hematopoietic stem cell transplantation: clinical use and perspectives. Biol Res. 2012;45(3):307316. doi:10.4067/S0716-97602012000300012

2. Passweg JR, Baldomero H, Bader P, et al. Use of haploidentical stem cell transplantation continues to increase: the 2015 European Society for Blood and Marrow Transplant activity survey report. Bone Marrow Transplant. 2017;52(6):811817. doi:10.1038/bmt.2017.34

3. Gudiol C, Garcia-Vidal C, Arnan M, et al. Etiology, clinical features and outcomes of pre-engraftment and post-engraftment bloodstream infection in hematopoietic SCT recipients. Bone Marrow Transplant. 2014;49(6):824830.

4. Kikuchi M, Akahoshi Y, Nakano H, et al. Risk factors for pre- and post-engraftment bloodstream infections after allogeneic hematopoietic stem cell transplantation. Transpl Infect Dis. 2015;17(1):5665.

5. Mori Y, Yoshimoto G, Nishida R, et al. Gastrointestinal Graft-versus-Host Disease Is a Risk Factor for Postengraftment Bloodstream Infection in Allogeneic Hematopoietic Stem Cell Transplant Recipients. Biol Blood Marrow Transplant. 2018;24(11):23022309.

6. Mikulska M, Raiola AM, Galaverna F, et al. Pre-Engraftment Bloodstream Infections after Allogeneic Hematopoietic Cell Transplantation: impact of T Cell-Replete Transplantation from a Haploidentical Donor. Biol Blood Marrow Transplant. 2018;24(1):109118.

7. Weisser M, Theilacker C, Tschudin Sutter S, et al. Secular trends of bloodstream infections during neutropenia in 15 181 haematopoietic stem cell transplants: 13-year results from a European multicentre surveillance study (ONKO-KISS). Clin Microbiol Infect. 2017;23(11):854859.

8. Poutsiaka DD, Munson D, Price LL, Chan GW, Snydman DR. Blood stream infection (BSI) and acute GVHD after hematopoietic SCT (HSCT) are associated. Bone Marrow Transplant. 2011;46(2):300307.

9. Youssef A, Hafez H, Madney Y, et al. Incidence, risk factors, and outcome of blood stream infections during the first 100 days post-pediatric allogeneic and autologous hematopoietic stem cell transplantations. Pediatr Transplant. 2020;24(1):e13610.

10. Wang CH, Chang FY, Chao TY, et al. Characteristics comparisons of bacteremia in allogeneic and autologous hematopoietic stem cell-transplant recipients with levofloxacin prophylaxis and influence on resistant bacteria emergence. J Microbiol Immunol Infect. 2018;51(1):123131. doi:10.1016/j.jmii.2016.02.003

11. Forcina A, Lorentino F, Marasco V, et al. Clinical Impact of Pretransplant Multidrug-Resistant Gram-Negative Colonization in Autologous and Allogeneic Hematopoietic Stem Cell Transplantation. Biol Blood Marrow Transplant. 2018;24(7):14761482. doi:10.1016/j.bbmt.2018.02.021

12. Averbuch D, Tridello G, Hoek J, et al. Antimicrobial Resistance in Gram-Negative Rods Causing Bacteremia in Hematopoietic Stem Cell Transplant Recipients: intercontinental Prospective Study of the Infectious Diseases Working Party of the European Bone Marrow Transplantation Group. Clin Infect Dis. 2017;65(11):18191828. doi:10.1093/cid/cix646

13. Girmenia C, Rossolini GM, Piciocchi A, et al. Infections by carbapenem-resistant Klebsiella pneumoniae in SCT recipients: a nationwide retrospective survey from Italy. Bone Marrow Transplant. 2015;50(2):282288. doi:10.1038/bmt.2014.231

14. Freifeld AG, Bow EJ, Sepkowitz KA, et al. Clinical practice guideline for the use of antimicrobial agents in neutropenic patients with cancer: 2010 update by the infectious diseases society of america. Clin Infect Dis. 2011;52(4):e5693.

15. Arendrup MC, Prakash A, Meletiadis J, Sharma C, Chowdhary A. Comparison of EUCAST and CLSI Reference Microdilution MICs of Eight Antifungal Compounds for Candida auris and Associated Tentative Epidemiological Cutoff Values. Antimicrob Agents Chemother. 2017;61(6):6. doi:10.1128/AAC.00485-17

16. Han TT, Huang XJ, Liu KY, et al. [Blood stream infections during agranulocytosis period after hematopoietic stem cell transplantation in one single center]. Zhonghua Nei Ke Za Zhi. 2011;50(8):654658.

17. Mikulska M, Del Bono V, Bruzzi P, et al. Mortality after bloodstream infections in allogeneic haematopoietic stem cell transplant (HSCT) recipients. Infection. 2012;40(3):271278. doi:10.1007/s15010-011-0229-y

18. Stoma I, Karpov I, Milanovich N, Uss A, Iskrov I. Risk factors for mortality in patients with bloodstream infections during the pre-engraftment period after hematopoietic stem cell transplantation. Blood Res. 2016;51(2):102106. doi:10.5045/br.2016.51.2.102

19. Stoma I, Littmann ER, Peled JU, et al. Compositional flux within the intestinal microbiota and risk for bloodstream infection with gram-negative bacteria. Clin Infect Dis. 2020. doi:10.1093/cid/ciaa068

20. Puerta-Alcalde P, Cardozo C, Marco F, et al. Changing epidemiology of bloodstream infection in a 25-years hematopoietic stem cell transplant program: current challenges and pitfalls on empiric antibiotic treatment impacting outcomes. Bone Marrow Transplant. 2020;55(3):603612. doi:10.1038/s41409-019-0701-3

21. Blennow O, Ljungman P, Sparrelid E, Mattsson J, Remberger M. Incidence, risk factors, and outcome of bloodstream infections during the pre-engraftment phase in 521 allogeneic hematopoietic stem cell transplantations. Transpl Infect Dis. 2014;16(1):106114. doi:10.1111/tid.12175

22. Liu C-Y, Lai Y-C, Huang L-J, et al. Impact of bloodstream infections on outcome and the influence of prophylactic oral antibiotic regimens in allogeneic hematopoietic SCT recipients. Bone Marrow Transplantation. 2020;55(3):12311239. doi:10.1038/bmt.2010.286

23. Wang L, Wang Y, Fan X, Tang W, Hu J. Prevalence of Resistant Gram-Negative Bacilli in Bloodstream Infection in Febrile Neutropenia Patients Undergoing Hematopoietic Stem Cell Transplantation: A Single Center Retrospective Cohort Study. Medicine. 2014;16(1):e1931. doi:10.1097/MD.0000000000001931

24. Tumbarello M, Viale P, Viscoli C, et al. Predictors of mortality in bloodstream infections caused by Klebsiella pneumoniae carbapenemase-producing K. pneumoniae: importance of combination therapy. Clin Infect Dis. 2012;55(7):943950. doi:10.1093/cid/cis588

25. Qureshi ZA, Paterson DL, Potoski BA, et al. Treatment outcome of bacteremia due to KPC-producing Klebsiella pneumoniae: superiority of combination antimicrobial regimens. Antimicrob Agents Chemother. 2012;56(4):21082113.

26. Zhang R, Liu L, Zhou H, et al. Nationwide Surveillance of Clinical Carbapenem-resistant Enterobacteriaceae (CRE) Strains in China. EBioMedicine. 2017;19:98106.

27. Taur Y, Xavier JB, Lipuma L, et al. Intestinal domination and the risk of bacteremia in patients undergoing allogeneic hematopoietic stem cell transplantation. Clin Infect Dis. 2012;55(7):905914.

28. Mousset S, Buchheidt D, Heinz W, et al. Treatment of invasive fungal infections in cancer patients-updated recommendations of the Infectious Diseases Working Party (AGIHO) of the German Society of Hematology and Oncology (DGHO). Ann Hematol. 2014;93(1):1332.

29. de Naurois J, Novitzky-Basso I, Gill MJ, et al. Management of febrile neutropenia: ESMO Clinical Practice Guidelines. Ann Oncol. 2010;21(Suppl 5):v252256.

30. Mackall C, Fry T, Gress R, et al. Background to hematopoietic cell transplantation, including post transplant immune recovery. Bone Marrow Transplant. 2009;44(8):457462.

31. Ge J, Yang T, Zhang L, et al. The incidence, risk factors and outcomes of early bloodstream infection in patients with malignant hematologic disease after unrelated cord blood transplantation: a retrospective study. BMC Infect Dis. 2018;18(1):654.

32. Laughlin MJ, Eapen M, Rubinstein P, et al. Outcomes after transplantation of cord blood or bone marrow from unrelated donors in adults with leukemia. N Engl J Med. 2004;351(22):22652275.

33. Rocha V, Labopin M, Sanz G, et al. Transplants of umbilical-cord blood or bone marrow from unrelated donors in adults with acute leukemia. N Engl J Med. 2004;351(22):22762285.

Original post:
[Full text] Clinical Analysis of Bloodstream Infections During Agranulocytosis Aft | IDR - Dove Medical Press

Introduction

Breast cancer is the most frequently diagnosed malignancy and a leading cause of death in women worldwide.1 Triple-negative breast cancer (TNBC) is a highly malignant and invasive subtype of breast cancer, and is defined by the lack of estrogen receptor (ER), progesterone receptor (PR), and human epidermal growth factor receptor 2 (HER2/neu) expression.2 TNBC accounts for 15~20% of all breast cancer and is more common in young women under the age of 40. It has a high recurrence rate, a high potential for metastasis, and a poor clinical prognosis, and is defined as a refractory breast cancer owing to its resistance to treatment. Among all the breast cancer subtypes, TNBC has the highest rate of distant metastasis and is associated with the shortest overall survival (OS).3 Despite undergoing surgical resection and adjuvant chemotherapy, half of all primary TNBC patients in whom the tumor is confined to the breast and lymph nodes have a distant recurrence within five years, and are prone to metastasis to the central nervous system (CNS) and internal organs such as the liver, bones, the lung.4 Once distant metastasis has occurred, the survival time of TNBC patients is greatly shortened.

Metastasis to the brain remains the most intractable issue for patients with metastatic breast cancer. Brain metastasis (BM) formation will not only affect the physical function, independence, personality, quality of life, and self-awareness of the patients but will also greatly increase the mortality rate compared with metastasis to other organs, which can be as high as 80% within one year.5 BM accounts for most CNS tumors, but the incidence varies depending on the type of primary malignancy6,7 (Figure 1). The subtype of primary breast cancer is critical for metastatic behavior and OS. The incidence of BM is as high as 46% among patients with advanced TNBC, with 14% presenting with BM at initial diagnosis of metastatic TNBC, and is significantly higher than that for hormone receptor (HR)-positive and HER2-positive breast cancer. TNBC is associated with high metastatic potential, particularly to the brain. Compared with that for hormone receptor-positive and HER2-positive breast cancers, TNBC-derived BM (TNBCBM) occurs earlier and is more often accompanied by extracranial systemic lesions. Patients with TNBCBM also have a much shorter survival time, with a median OS of approximately 6 months,811 and the worst breast cancer-specific survival (BCSS) and OS.12

Figure 1 Proportional etiology of brain metastasis. Of all CNS tumors, 15% are primary (red), while 85% are from metastases (blue). The incidence of BM is higher in lung cancer (35%) and breast cancer (30%) than other primary cancers. In breast cancer, triple-negative subtypes have the highest rate of BM, followed by HER2+ and luminal subtypes.

Differences between the intrinsic molecular subtype of the primary breast cancer and matched BM represent a complex problem that merits further investigation. In approximately 20% of breast cancer patients, differences in receptor expression exist between the primary cancer and the associated BM, with the most significant manifestations being decreased ER and/or PR expression and increased HER2 expression. About 18% of TNBC patients gain ER/PR and HER2 expression. This difference in receptor expression may account for the unresponsiveness or resistance of intracranial disease to systemic therapy.13 Traditional therapies have very low efficacy in the treatment of TNBCBM. Additionally, most cytotoxic drugs are restricted in their entry into the CNS, and because TNBC is negative for ER and HER2 expression, endocrine therapy and anti-HER2-targeted therapy are ineffective. Surgical resection of BM is usually limited to isolated metastases, and it is not possible to diagnose the presence of space-occupying lesions in the brain as BM. Consequently, radiotherapy remains the main treatment method for BM. However, the OS is still short even after whole-brain radiotherapy (WBRT) or stereotactic radiotherapy, and patients are prone to brain edema, high intracranial pressure, local brain necrosis, memory and vision loss, and other radiation-related injuries. To date, there are no standard systemic treatments for TNBCBM. Moreover, gene expression patterns in primary TNBCs do not predict the occurrence of BM in this population.11 These observations highlight the need to identify potential biomarkers and elucidate the genetic characteristics of patients at high risk of BM to aid in clinical decision-making. Meanwhile, to effectively manage the disease and prolong the survival of TNBCBM patients, it is necessary to better understand the patterns of BM formation, including the nature and function of TNBC cells and the bloodbrain/bloodtumor barriers, the biological characteristics of BM, and the microenvironment of the CNS. In this review, we provide a systematic overview of TNBCBM occurrence and development, as well as of potential therapeutic targets.

TNBC is a subclass of ER-negative breast cancer. Due to the lack of ER expression, it has been generally believed that estrogen signaling is not involved in the occurrence and development of ER-negative breast cancer. However, this is not supported by existing evidence. Wang et al identified and cloned a 36-kDa ER variant, called ER-36, that was mainly localized to the cytoplasm and the plasma membrane.14 ER-36 lacks both the AF-1 and AF-2 transcription activation domains of the full-length 66-kDa ER- (ER-66) protein but retains the DNA-binding domain and partial dimerization and ligand-binding domains, which is consistent with the fact that ER-36 has no intrinsic transcriptional activity, but instead mediates nongenomic estrogen signaling.15 ER-36 was found to be highly expressed in TNBC, and knockdown of ER-36 reduced the response of TNBC cells to estrogen. Meanwhile, ER-36 and EGFR regulated each others expression through a positive feedback loop in TNBC cells, which promoted their malignant growth.16 Studies have also shown that ER-36 can mediate estrogen-induced cyclin D1 promoter activity through the Scr/EGFR/STAT5 pathway, leading to increased TNBC cell proliferation.17,18 ER-36 plays an important role in the development and progression of TNBC cells, and may represent a therapeutic target for the treatment of TNBC.

In recent decades, cancer stem cells (CSCs), or cancer stemness, has attracted substantial research interest. CSCs are considered to be a decisive factor in tumor heterogeneity and the leading cause of tumor metastasis and recurrence. TNBC tissue is reported to be enriched for the expression of ALDH1 and the CD44+/CD24 phenotype when compared with other breast cancer subtypes,19,20 while TNBC cells are also more likely to form mammospheres than non-TNBC cells.19,21 At the transcriptional level, pluripotency-related transcription factors, such as MYC and SOX2, are highly expressed in TNBC and are positively correlated with poor prognosis.22,23 A recent study found that the gene signature of TNBC cells was remarkably similar to that of CSCs, and the stem cell signature was significantly enriched in TNBC cell lines compared with that in non-TNBC cell lines.24 In summary, TNBC cells exhibit CSC characteristics and activity at both the molecular and transcriptional levels.

The epithelial-to-mesenchymal transition (EMT) genetic program is highly associated with cancer cell metastasis.25 One study analyzed EMT in circulating tumor cells (CTCs) in breast cancer patients and found that it plays an important role in the blood-borne transmission of breast cancer.26 Increasing evidence has indicated that a close relationship exists between TNBC, and EMT and the CSC phenotype. Ectopic overexpression of EMT-promoting transcription factors, such as Snail, Twist, and Zeb1, confers CSCs-like features on mammary epithelial cells, suggesting that EMT may be a key process for the ab initio production of CSCs, and a viable mechanism for the metastatic dissemination of breast tumors.27,28 Interestingly, TNBC cells exhibit high expression levels of key EMT-inducing transcription factors, concomitant with increased levels of mesenchymal-related proteins, and reduce expression of epithelial-associated proteins.29 Additionally, mesenchymal phenotypes are mainly responsible for the invasive and chemoresistant properties of TNBC cells.30,31 TNBC-associated EMT not only includes acquiring migratory and invasive ability, but also involves the complex reprogramming of cells to allow their adaptation to the harsh conditions of the body and facilitate invasion and metastasis. Epigenetic changes differ significantly between TNBC and non-TNBC tissues, including those associated with long noncoding RNAs (lncRNAs), microRNAs (miRNAs), and histone and DNA modifications. Studying these changes holds promise for the development of new treatments and the identification of EMT-related biomarkers.32 Leptin, a key factor in obesity, is also known to be a risk factor for breast cancer, including TNBC. Leptin can promote a CSC/EMT phenotype and upregulate the expression of multiple CSC-/EMT-related genes, including FOXC2, TWIST2, VIM, AKT3 and SOX2. Increased leptin signaling is causally associated with obesity-related TNBC through promoting CSC enrichment and EMT.33

Multiple self-renewal signaling pathways (SRSPs) have been reported to be abnormally activated in TNBC cells, such as those associated with the signal transducer and activator of transcription (STAT), protooncogene tyrosine-protein kinase Src (SRC), and Wnt/-catenin pathways. The dysregulation of SRSPs leads to a loss of regulatory balance through both intrinsic and extrinsic mechanisms, which helps the widespread dissemination of TNBC cells. Inhibiting aberrantly activated SRSPs to reduce stemness has been shown to exert a therapeutic effect on TNBC to a certain extent.24,34

Early maturation and/or a higher expression of elements associated with inflammation and aging in TNBC patients are often observed in the early invasion of TNBC cells. The inhibition of nuclear factor kappa B (NF-B), a marker of the inflammatory response, can reduce the proliferative and invasive ability of TNBC cells.35 Adenosine plays an important role in inflammation and tumor development. The expression of adenosine A2b receptor (ADORA2B) is higher in TNBC cells than in luminal and HER2-positive breast cancer, and ADORA2B may drive cancer metastasis by reducing cell adhesion and MAPK-dependent signaling activation. The knockout of ADORA2B in TNBC cells reduces their metastasis in vivo as well as their viability and colony-forming ability.36 Telomerase, which is closely related to aging, plays a key role in tumor development, and most tumors achieve proliferative immortality by activating telomeres. Telomere shortening is more pronounced in more aggressive breast cancer subtypes, especially TNBC.37

The BBB is a complex structure formed by brain endothelial cells (BECs), pericytes, and astrocyte foot processes. The BBB is a highly selective barrier between the circulating blood and the brain parenchyma, and is necessary to maintain brain homeostasis. The passage of cells and solutes through the BBB is limited by their molecular weight and charge.38 The BBB selectively regulates substances entering the brain and protects it from toxic substances, including chemicals and targeted drugs. Tight junction (TJ) proteins are characteristic of BECs and restrict the paracellular diffusion of substances between the blood and the brain (Figure 2). Brain capillaries are characterized by high electrical resistance that increases the impermeability of the BBB to polar and ionic substrates. Damage to TJs can lead to a leaky BBB and the continuous exposure of the CNS to harmful substances in the circulation. Additionally, changes in intracellular transport in BECs contribute to BBB disruption and disease progression.39

Figure 2 Triple-negative breast cancer brain metastasis (TNBCBM) and the composition of the bloodbrain barrier (BBB) and bloodtumor barrier (BTB). (A) TNBC cells separate from the primary site and are transported to the brain via the blood; they eventually colonize the brain, forming BM. (B) The BBB is a complex structure formed via the physicochemical interactions of brain endothelial cells, pericytes, astrocytes, tight junctions, and efflux pumps, and is highly selective for endogenous and exogenous substances. (C) Cancer cells cross the BBB and stimulate abnormal (immature) angiogenesis, which is characterized by a fenestrated vasculature with increased permeability (the BTB). This change facilitates the entry of otherwise restricted substances into the brain parenchyma.

The occurrence of BM requires that tumor cells cross the BBB. The BBB plays a dual role in cancer cell BM, both forming a tight barrier to protect the CNS from invading tumor cells, while also protecting metastatic cells during extravasation and proliferation in the brain.40 The loss of BBB integrity due to neuroinflammation, upregulation of proteolytic enzymes, and direct destruction by TNBC cells may promote metastatic invasion.41 The partial destruction of the BBB leads to increased invasion of tumor cells and related molecules, thereby potentially promoting tumor cell brain colonization. When tumor cells enter the brain, they mainly gather at the branching points of cerebral vessels and further exude and invade.42 Metastatic tumor cells interact with BECs through surface molecules, including selectins, integrins, and chemokines. This is accompanied by the secretion of growth factors such as vascular endothelial growth factor (VEGF), neuropeptide, chemokines and cyclooxygenase 2 (COX2), which further weaken the BBB and allow tumor cells to penetrate the brain parenchyma.43 Avraham et al observed that TNBC cells disrupted the BBB, increased BBB permeability, and changed the structure of the TJ proteins ZO-1 and claudin-5. Meanwhile, angiopoietin-2 (Ang-2) expression was elevated in brain microvascular endothelial cells (BMECs). Targeted inhibition of Ang-2 prevented BMEC instability and the disruption of BBB integrity, thereby helping to inhibit TNBC cell colonization in the brain.44 TNBCBM was negatively correlated with the expression of glucose transporter 1 (GLUT1) and/or breast cancer resistance protein (BRCP) in intratumoral microvessels, suggesting that TNBCBM might be related to the disruption of the BBB.45

A comparison of the gene expression profiles of primary breast cancer samples that metastasized to the brain with those that metastasized to other organs, showed that the regulation of T cell activation was more prominent in BM-related samples (P<0.00002). Other studies have shown that T lymphocytes can increase the ability of breast cancer cells, especially ER-negative breast cancer, to cross the BBB and promote tumor invasion and metastasis in the brain tissue. These effects may have been mediated through the upregulation of guanylate-binding protein 1 (GBP1) at both the mRNA and protein levels.46 Another study showed that the increased GBP1 protein expression was associated with metastasis and poor prognosis in TNBC.47

Increasing evidence suggests that a close relationship exist between the gut microbiome and CNS diseases. Gut infection or dysbiosis of the gut microbiome promotes a series of changes in the BBB through interaction with the peripheral immune and neuroimmune systems. Factors secreted by gut microorganisms enter the circulation and interact with various immune cells (including T cells), thereby stimulating effector T cell differentiation, which can promote T cell brain infiltration. Meanwhile, circulating bacterial factors can up-regulate inflammatory cytokines levels, which can affect BBB integrity and promote neuroinflammation and CNS diseases.48

Similar to the BBB, the presence of the BTB also limits the access of potentially effective drugs to BM. The excessive production of proangiogenic factors in metastatic tumors, such as BM from breast cancer or other cancers, stimulates abnormal angiogenesis, resulting in a vasculature characterized by the presence of fenestrated vessels that increase paracellular permeability, referred to as the BTB (Figure 2).49 In contrast to the normal BBB, the BTB is leaky and tends to allow the extravasation of lager molecules.50 However, BTB permeability exhibits clear heterogeneity, both within lesions and among the BMs of different breast cancer subtypes. High expression of the pericyte protein desmin was shown to be correlated with the increased permeability of the BTB, indicative of the involvement of vascular remodeling.51

Understanding the cellular and molecular changes inherent to the transformation of the BBB to a BTB, and then from a poorly permeable BTB to a highly permeable one, may identify targetable pathways to improve the efficacy of drug therapy in the brain. When BM occurs, the components of endothelial cells, pericytes, astrocytes, and microglia change. Lyle et al indicated that the transformation of a BBB to a BTB did not involve random destruction of the BBB, but rather a consistent change in multiple BBB cell components. BTB permeability varies from tumor to tumor or even within each metastasis. When BMs grow beyond their blood supply, they become hypoxic, thus causing tumor cells to secrete VEGF and induce neovascularization. VEGF expression in TNBCBM, is 1.08105-fold that of the uninvolved brain, and is significantly higher than that in HER2-positive cancer and inflammatory breast cancer. Notably, the increased expression of a desmin+ subpopulation of pericytes, and the decreased expression of CD13+ pericytes and laminin 2 were associated with higher permeability in TNBCBM.52,53

The mechanisms involved in BM progression once the TNBC cells have crossed the BBB remain poorly understood. Studies focusing on gene expression levels have shown that numerous genes play important roles in regulating tumor metastasis. High-resolution clonal mapping of multiorgan metastasis in TNBC revealed that tumors at different metastatic sites display specific gene patterns. Although brain, lung, liver, and multiorgan metastatic tumors have similar genetic characteristics, their gene expression programs can vary, possibly due to the diverse organ microenvironments.54 Siegel et al showed that gene mutations that originated in the primary tumors were maintained throughout metastatic spreading. These authors also showed that TP53 was the only driver gene that was mutated in all the subtypes of breast cancer metastasis analyzed, and that the alterations in other driver genes were mainly associated with somatic copy number alterations (CNAs). This study further expanded on the evidence of multiclonal seeding across multiple subtypes of breast cancer, especially for TNBC.55 Some studies have also implicated genes such as NAMPT, SREBP1, and MTHD as drivers of TNBC metastatic progression.5658 Inactivating mutations in ARID1A are more common in TNBCBMs (83%) than in HER2-positive (51%) or HR-positive (71%) tumors.59 Interestingly, mutations in ARID1A often occur together with mutations in PIK3CA or PTEN, and double mutations involving ARID1A and PIK3CA or PTEN result in ovarian tumor formation in mice, suggesting that PI3K and chromatin remodeling pathways play a synergistic carcinogenic role in TNBCs.60 However, further studies are needed on the role of ARID1A expression in TNBCBMs. Qian et al analyzed the gene expression profiles of 4801 breast cancer patients from 27 publicly available breast cancer datasets, and found that a Chromosome 3q 19-gene signature was closely associated with breast cancer-related aggressiveness and reduced distant metastasis-free survival, especially in TNBC. They further identified that the 3q signature was an independent predictor of metastasis to the brain in TNBC patients (hazard ratio [HR]: 1.61, 95% confidence interval [CI]: 1.21~2.13; P=0.001). PIK3CA is one of the most extensively studied oncogenes among the 3q 19-gene signature. The authors of this study also reported that PIK3CA expression was significantly correlated with BM, while PIK3CA mRNA expression was correlated to its CNAs, but not mutation status, in breast cancer.61

Epigenetic changes are increasingly recognized as key events in breast cancer progression. Yomtoubian et al identified enhancer of zeste homolog 2 (EZH2) as a major driver of TNBC progression through a meta-analysis of epigenetic genes. TNBC cells with high EZH2 expression exhibited stronger metastatic potential, and blockading the catalytic activity of EZH2 could reduce TNBC dissemination and metastasis.62 Among identified TNBC-specific transcription factors, engrailed 1 (EN1) was found to be high expressed in TNBC, and was associated with the regulation of neurogenesis-related genes (such as NLGN4X and other neuroligin-encoding genes) and an increased risk of BM in TNBC patients.63 In conclusion, studies relating to molecular and genetic variants associated with TNBCBM provide hope for the prevention of BM in high-risk TNBC patients.

The process of distant metastasis is extremely inefficient, with less than 0.01% of primary tumor cells completing the invasionmetastasis cascade and forming metastases in secondary organs.64 Most cancers are known to show an organ-specific pattern of metastasis, which suggests that metastatic growth is not random, but is instead influenced by the microenvironment of the secondary organs. A better understanding of the mechanisms of metastatic diseases in recent years has tended to support the seed and soil hypothesis proposed by Steven Paget.65 The spread of tumor cells is determined by the interaction and cooperation between the cancer cells (seeds) and the secondary organ (soil), and only falling on suitable soil can contribute to the colonization of seeds. The unique biological characteristics and specific cells and molecular components of the secondary organ microenvironment promote the formation of metastasis, and blocking these signals may help to inhibit this process.66

TNBC exhibits numerous CSC-like traits and is more likely to lead to BM. The short time to BM occurrence in TNBC and the short survival time after BM diagnosis may be indicative of an innate ability of TNBC cells to adapt to the brain microenvironment.67 The vascular basement membrane presents the soil in BM. Although more than 95% of early brain micrometastases were shown to coexist with blood vessels, there is little evidence for isolated neurogenic growth.68 When TNBC cells invade the brain parenchyma, an adequate blood supply is needed to provide the nutrients necessary for tumor growth and proliferation. Tumor angiogenesis depends on the balance between pro- and anti-angiogenic factors at the local tissue level and is regulated by the local microenvironment.69

When TNBC cells cross the BBB, TNBC cells begin to interact with the extracellular matrix (ECM), brain parenchymal resident cells (astrocytes and other stromal cells), and paracrine signaling molecules (cytokines and growth factors) in the brain microenvironment. Primary TNBC cells locally invade and systemically disseminate through EMT-related processes, while the reverse (mesenchymal-to-epithelial transition; MET) is involved in metastatic colonization in the brain.70 Zhang et al demonstrated that, in the brain microenvironment, epigenetic regulation mediated by astrocyte-derived miRNA could reduce the expression of PTEN, which is normally expressed in human and mouse tumor cells. The loss of the expression of this tumor suppressor gene promoted the growth of brain metastatic tumor cells by enhancing proliferation and reducing apoptosis. A subsequent blockade of astrocyte secretion restored PTEN levels and suppressed BM in vivo, reflecting the dependence of BM on the brain microenvironment. This study also found that the loss of PTEN was associated with the TNBC subtype and predicted a shorter survival time.71 Hohensee et al further demonstrated that the loss of PTEN expression was significantly associated with TNBCBM (P=0.001) and shorter survival time after surgical BM resection (P=0.048). In an in vitro model, the upregulation of PTEN in TNBC led to reduced cell migration and invasion to the brain, which was primarily mediated by autocrine and paracrine activation of the GM-CSF/CSF2RA and AKT/PTEN pathways.72

Tumor-associated macrophages (TAMs) are important components of the metastatic microenvironment. Metastasis-associated macrophages (MAMs) show TNBCBM site-dependent differences in their molecular profiles. Lymphotoxin was the most significantly upregulated cytokine in TNBC cells metastasized to the brain parenchyma compared with that in the dura mater and was suggested to be directly involved in the M2 polarization of brain parenchymal MAMs. This suggested that there may be a link between the site specificity of metastatic TNBC cells and the MAM activation state.73 BM is also modified by other CNS microenvironment-derived factors. The expression of gamma-aminobutyric acid (GABA) transporters was increased in BMs derived from TNBC and HER2-positive breast cancer compared with that in matched primary tumor tissues and the BMs, particularly TNBCBMs, were able to proliferate by metabolizing GABA as a biosynthetic energy source, which was more prominent in TNBCBM.74

A better understanding of the immunogenicity of the BM environment may help explain how immunotherapy can help in the treatment of BM, although this is still in its infancy. Tumor-infiltrating lymphocytes (TILs) have a prognostic role in TNBC, with higher levels of TILs being associated with a lower rate of distant metastasis. The immune environment in BM is poorly characterized. TIL levels are lower in BM than in primary breast cancer, and the number of CD4+ and CD8+ T cells was significantly decreased in the brain.75 A recent study also showed that BMs have reduced immune cell recruitment (including CD8+ T cells, regulatory T cells, and dendritic cells) but increased relative levels of M2-like macrophages when compared with their matched primary breast cancers, particularly the TNBC subtype.76 The lower infiltration of immune cells in BM may be due to immune escape. Sambade et al studied four histological biomarkersgliosis, immune infiltrate, hemorrhage, and necrosisand their prognostic significance in BMs. In 203 BM samples, necrosis was significantly higher in TNBCBMs (comprising 38% of the 203 samples) than in BMs derived from other breast cancer subtypes (P<0.01). Gliosis was associated with improved OS in TNBC (P=0.02), while immune infiltrate (P=0.001) and hemorrhage (P=0.07) were associated with the HER-positive subtype.77 Immune cells are involved in, and constantly change during, the progression of the primary tumor and its metastatic cascade within individual patients.

Metabolic adaptations are also important for the growth and survival of metastatic TNBC cells within the CNS environment. Enzymes involved in glucose-associated aerobic and anaerobic processes are upregulated to meet the high energy demands of metastatic cells in the brain, enabling them to survive and proliferate within the low-glucose microenvironment.7 Metabolic reprogramming is increased in TNBCBM cells, and glucose metabolism is more intensive. GLUT3 is crucial for the survival of TNBC cells in the brain, while its overexpression promotes prometastatic signaling in TNBCBM cells, and also significantly enhances the malignant behavior of TNBC cells.78 TNBC mostly displays high levels of glycolysis. The level of glycolysis is higher in BM cells than in other metastatic sites or the associated primary cancer. The upregulated expression of lactate dehydrogenase A (LDH-A), which catalyzes the final step of glycolysis, is closely associated with TNBCBM. The upregulation of LDH-A enhances the adaptation of TNBC cells to the brain environment and is also a reflection of a high metabolic rate, thus contributing to tumor proliferation.79 Meanwhile, metastatic cells can also utilize the abundant amino acids (glutamine, branched-chain amino acids) in the CNS to carry out amino acid-dependent gluconeogenesis and store glycogen.7 Valine is an essential branched-chain amino acid catabolized in the brain. Kalita-de Croft et al analyzed the proteomic characteristics of TNBCBM and found that 3-hydroxyisobutyryl-CoA hydrolase (HIBCH) was essential for gluconeogenic valine catabolism in the brain; HIBCH was strongly induced in BM, and was mostly expressed at metastatic margins and hemorrhagic areas. Their findings further supported that valine catabolism may be an effective adaptation of TNBC cells to the brain microenvironment, and that its intermediates or products can be transferred from tumor-associated glial cells.80 The upregulation of lipolysis promotes metastasis, especially in TNBCBM. Oncogenic lipid signaling supports TNBC cell migration to the brain by promoting cell survival, migration, and invasion. The inhibition of key enzymes in lipolysis, such as monoacylglycerol lipase (MAGL) and alkyl glycerophosphate synthase (AGPS), reduces the metastatic potential of tumor cells. The metabolic phenotypes differ among different breast cancer subtypes, with the TNBC exhibiting the metabolically active Warburg/mixed phenotypes.81,82 A recent study reported that estradiol may upregulate neurotrophin receptor tropomyosin kinase receptor B (TRKB) signaling in premenopausal women with TNBC, thereby promoting BM development.83 Because of the increased metabolism associated with TNBCBM, patients with this condition may benefit the most from metabolic interventions. Understanding the BM microenvironment may contribute to identifying prognostic factors and new therapeutic strategies.

The development of TNBCBM involves a complicated multifactorial metastatic cascade. The main steps of metastasis include TNBC cell detachment from the primary site; invasion of the surrounding stromal and basement membrane; survival in the circulatory system (intravasation and extravasation); breaking down the BBB; the formation of a highly permeable BTB; CNS invasion; and BM colonization.42 The metastatic cascade is summarized in Figure 3.

Figure 3 Summary of the metastatic cascade and pathways promoting brain metastasis. The upward arrows () indicates increased expression, and () indicates overexpression. The down arrow () represents a reduction, and () represents a significant reduction.Abbreviations: TNBC, triple-negative breast cancer; CSC, cancer stem cell; EMT, epithelial-to-mesenchymal transition; SRSP, self-renewal signaling pathway; STAT, signal transducer and activator of transcription; SRC, protooncogene tyrosine-protein kinase Src; VEGF, vascular endothelial growth factor; EGFR, epidermal growth factor receptor; MMP, matrix metalloproteinase; BBB, blood-brain barrier; BTB, bloodtumor barrier; TAM, tumor-associated macrophage; TIL, tumor-infiltrating lymphocyte; MET, mesenchymal-to-epithelial transition; LDH-A, lactate dehydrogenase A.

The widespread concern that most drugs are not likely to penetrate the BBB results in the exclusion of patients with breast cancer and other primary tumors from clinical trials.84 This reduces the exposure of BM patients to potentially beneficial novel agents and limits important correlative studies of brain-specific tumor responses. However, new treatment options are urgently needed for TNBCBM patients. In recent years, with a deeper understanding of the molecular changes occurring in TNBC, several promising clinical strategies have emerged, including, among others, treatment with poly adenosine diphosphate-ribose polymerase (PARP) inhibitors, VEGF inhibitors, and immune checkpoint inhibitors, which are currently under evaluation. Here, we review the completed TNBCBM-related clinical trials (Table 1) and summarize those that are ongoing (Table 2).

Table 1 Selected Completed Clinical Trials for Triple-Negative Breast Cancer Brain Metastasis (TNBCBM)

Table 2 Selected Ongoing Clinical Trials for Triple-Negative Breast Cancer Brain Metastasis (TNBCBM)

PARP is a key enzyme in DNA single-strand break repair. PARP inhibitors prevent self-repair in BRCA 1/2-mutated cancer cells and induce PARP capture at the site of DNA damage; this, in combination with cytotoxic DNA-damaging chemotherapeutic drugs (such as platinum analogs), accelerates cancer cell death.85 A preclinical study demonstrated that carboplatin combined with veliparib (a PARP inhibitor) could reduce BBB permeability, inhibit the growth of TNBC-derived intracranial metastatic tumors, and improve prognosis.86 A phrase II clinical trial combining cisplatin with veliparib for the treatment of TNBCBM with or without BRCA mutations is currently being conducted (NCT02595905) and is expected to be completed by October 31, 2021. Talazoparib belongs to a new generation of PARP inhibitors with strong catalytic inhibitory activity and has a 100-fold greater PARP-trapping potential than other PARP inhibitors currently under investigation. A Phase III clinical trial of talazoparib (EMBRACA) was conducted on 431 patients with advanced breast cancer and a germline BRCA1/2 mutation (including 190 TNBC patients). Among the patients with BM, median progression-free survival (PFS) was significantly longer in the talazoparib group than in the chemotherapy group (HR=0.32, 95% CI: 0.15~0.68), suggesting that talazoparib can penetrate the BBB.87 Another Phase II clinical trial (ABRAZO) demonstrated that talazoparib exerted antitumor activity in patients with advanced TNBCBM who had a previous response to platinum chemotherapy, as well as in those who received at least three previous cytotoxic regimens without prior platinum exposure. The objective response rate (ORR) of TNBC was 26%, and a longer platinum-free interval was associated with a higher response rate.88

Iniparib mainly acts by changing reactive oxygen species metabolism in tumor cells, and may also function as a PARP inhibitor. Its unique physical properties (ie, low molecular weight and lipophilic nature) may favor BBB penetration, making it a promising candidate for targeting BM. In a Translational Breast Cancer Research Consortium (TBCRC) 018 phase II clinical trial, a total of 34 TNBC patients with new or progressive BM were treated with iniparib combined with irinotecan and then evaluated for a curative effect. The median progression time was 2.14 months and the median OS was 7.8 months. The intracranial response rate (RR) was 12%, the intracranial clinical benefit rate (CBR) was 27%, and the treatment was well-tolerated.89

VEGF plays an important role in BM angiogenesis. Bevacizumab is a VEGF inhibitor that has shown potential in the treatment of breast cancer BM. A window period between the administration of bevacizumab and that of cytotoxic drugs may optimize the CNS response to advanced breast cancer BM, including TNBCBM, after WBRT.90 TNBC is the most immunogenic breast cancer subtype, rendering the inhibition of programmed cell death protein 1 receptor (PD-1) and programmed cell death protein 1 receptor ligand (PD-L1) attractive therapeutic targets. Atezolizumab (PD-L1 antibody) induces TNBC cell death/apoptosis and reduces their proliferative/metastatic potential and viability.91 One study suggested that immune checkpoint inhibitors may have therapeutic effects in BM.92 The IMpassion 130 phase III study showed that atezolizumab plus nab-paclitaxel prolonged PFS and OS among patients with metastatic TNBC, including those with BM.93

TNBCBM patients are still followed by the current medical community, and continuous exploration of valuable potential therapeutic targets is the priority of the future research. The ultimate goal is to reduce the incidence of BM and prolong the survival period of these patients. We review the emerging therapeutic targets with the aim of laying the foundation for the treatment of TNBCBM.

Growing evidence has indicated that miRNAs play a role in the different steps of BM development and that they can regulate the expression of multiple gene. Accordingly, miRNAs are regarded as attractive therapeutic targets for the treatment of cancer metastasis.94 Debeb et al showed that the overexpression of miR-141 in TNBC cells enhanced BM colonization, while its knockdown inhibited the ability of inflammatory TNBC to metastasize to the brain. Additionally, high miR-141 serum levels have been associated with shorter BM-free survival (P=0.04) and were independent predictors of PFS and OS. This suggests that miR-141 may be a regulator of TNBCBM and has the potential for use as a biomarker and potential target for the prevention and treatment of BM.95 Wang et al demonstrated that TNBC cells can secrete miR-122, which promotes metastasis by increasing nutrient availability in the premetastatic niche, and downregulates glucose uptake in astrocytes. The inhibition of miR-122 in vivo restored glucose uptake in distant organs (including the brain), thereby reducing the incidence of BM.96 MiR-509 significantly inhibited the ability of TNBC cells to metastasize to the brain through regulating the expression of two genesTNF and RHOCthat affect brain invasion.97 MiR-7 weakens the invasive and self-renewal ability of breast cancer stem cells by downregulating the expression of the KLF4 gene, thereby specifically inhibiting BM.98 Another study reported that miR-20b levels were increased in BM cells, including those derived from TNBC. MiR-20b also significantly enhanced the colony-forming ability of breast cancer cells as well as their aggressiveness; however, where miR-20b has potential as a therapeutic target remains unknown.99 Using next-generation sequencing (NGS), Sereno et al revealed that circulating miRNAs were dysregulated during TNBCBM progression. The authors found that the downregulation of miR-802-5p and miR-195-5p was a precocious event in TNBCBM, and that the transcription factor myocyte enhancer factor 2C (MEF2C) was a target of the two miRNAs, while MEF2C expression in TNBC cells was increased with BM development.100

Xing et al examined the lncRNA expression profiles in primary breast cancer and BM and found that Xinactive specific transcript (XIST) was the top differentially expressed lncRNA between the two groups. XIST expression was significantly downregulated in BM compared with other metastatic tumors, with the most significant reduction being recorded in the TNBC subtype. In the study, the authors also established a TNBCBM mouse model, and found that XIST downregulation led to the activation of three different pathways, namely, EMT, MSN/c-Met, and release of exosomal miR-503. Jointly, these pathways promoted the expression of metastatic traits in CSCs and triggered the upregulation of immunosuppressive factors in the CNS microenvironment through l exosome-mediated communication. In summary, lncRNA XIST exerts a metastasis-suppressive function preferentially in the brain, and its downstream pathway may be an effective target for the treatment of BM.101 Wang et al identified a lncRNA associated with breast cancer BM (lnc-BM), and found that the increased expression of lnc-BM in breast cancer cells (including TNBC cells) could drive BM progression, while lnc-BM depletion mediated through nanoparticle-encapsulated siRNAs elicited the opposite effect. Further investigation showed that interaction between lnc-BM and JAK2 enhanced the communication between breast cancer cells and the CNS microenvironment to promote BM. Targeting lnc-BM represents a potential strategy for treating BM.102

Circular RNA (circRNA) expression was compared between TNBCBM cells and parental nonspecific metastatic cells. The results showed that hsa_circ_0001944, hsa_circ_0001481, hsa_circ_0000646, hsa_circ_0001006 and hsa_circ_0000732 were upregulated, whereas hsa_circ_0001910, hsa_circ_0008285, and hsa_circ_0000002 were downregulated. Further analysis indicated that hsa_circ_0001944 might be involved in BM development by stimulating miR-509 and interfering with its binding to downstream targets.103

Membrane progesterone receptor alpha (mPR) is not associated with classical PR and is expressed in tissue lacking PR expression. Zhou et al demonstrated that mPR was highly expressed in TNBC tissues and that its expression level was negatively associated with TNM stage. The authors also showed that progesterone inhibited TNBC cell growth and metastasis to the brain via mPR, and provided evidence of a new mechanism, mediated by the progesterone/mPR axis, in the development and progression of TNBC. These observations suggest that, progesterone may be a potential target for the treatment of TNBCBM.104

ADAM8 is a transmembrane protein belonging to the a disintegrin and metalloprotease (ADAM) family. This protein is highly expressed in TNBC and derived metastases, and high ADAM8 levels predict poor prognosis. ADAM8 stimulates angiogenesis by releasing VEGF-A and promotes tumor cell proliferation by activating Integrin beta-1. Treatment with an anti-ADAM8 antibody could significantly reduce CTC numbers and BMs, suggesting that ADAM8 is a promising therapeutic target for TNBCBM treatment.105 Aldehyde dehydrogenase family 1 member A3 (ALDH1A3) is one of the representative proteins of EMT.106 A recent study identified ALDH1A3 as promoting BM development by regulating CTC adhesion and migration in the TNBCBM cascade. Knocking out ALDH1A3 has a selective inhibitory effect on BM, and dose not inhibit liver or bone metastasis.107 Gong et al found that inhibiting the expression of angiopoietin-like 4 (ANGPTL4), a secreted glycoprotein, in TNBC cells reduced metastatic growth in the brain. Furthermore, the secretion of transforming growth factor beta 2 (TGF-2) by astrocytes upregulated the expression of ANGPTL4 in TNBC cells. This finding suggests that the invading TNBC cells interact with astrocytes in the CNS microenvironment, and promotes BM through a TGF-2/ANGPTL4 axis.108 The increased expression of protocadherin 7 (PCDH7) in TNBC cells, induced through astrocyte interaction, has been reported to promote BM colonization. Furthermore, PCDH7 knockdown decreased metastatic lesion numbers and area sizes in the mouse brain.109 Dual-specificity phosphatase 6 (DUSP6) has been associated with breast cancer progression, recurrence, and metastasis. Wu et al found that, in TNBC patients, the DUSP6 protein was predominantly expressed in the nucleus of BM cells, but not in that of cells from lung or pleura metastasis; in contrast, DUSP6 was localized to the cytoplasm in primary tumor tissues. These results suggested that nuclear-localized DUSP6 expression may be associated with BM in TNBC patients, and thatDUSP6 peptide inhibitors may potentially reduce the risk of TNBC-related BM.110 The molecular chaperone B-crystallin is highly expressed in TNBC and is associated with the promotion of an aggressive phenotype. Furthermore,B-crystallin also has a role in promoting TNBC cell adhesion to BMECs, transendothelial migration, and BBB transmigration. The overexpression of B-crystallin increases BM occurrence in an orthotopic TNBC model, whereas B-crystallin silencing elicits the opposite effect.111

Gingerols are the main active components in ginger oleoresin. Martin et al reported that [10]-gingerol inhibits TNBC growth and spontaneous metastasis, especially that to the brain, by inducing caspase-dependent apoptosis.112 Cannabinoids derived from Cannabis sativa were shown to suppress TNBC growth in preclinical models. Furthermore, they could also inhibit tumor progression and invasion by reducing tumor angiogenesis, EGFR expression, and AKT phosphorylation, while also limiting the supply of nutrients and oxygen needed for tumor growth.113

Although the BM-related BBB (the BTB) is structurally impaired and has greater permeability than healthy BBB, it remains an important barrier to the delivery of drugs sites of to BM.51 In recent years, nanotechnology, has revolutionized how drugs are delivered and has unique advantages in the treatment of TNBCBM. Nanomaterials are used as carriers in chemotherapy, which can greatly improve the efficacy of conventional chemotherapy. They also allow drugs to freely cross the barriers of the body, such as the BBB, targeting drug delivery to specific lesions (such as BM). Additionally, through their high drug loading capacity, prolonged blood circulation time, capacity for sustained drug release, and potential for reduced enzyme-mediated drug degradation, nanomaterials can be used to maximize the benefits of treatment.114

Nanoparticles (NPs) loaded with doxorubicin (DOX), paclitaxel (PTX), or docetaxel (DTX) as therapeutic agents are currently the most studied formulations for treating metastatic breast cancer. Metastatic TNBC can be specifically targeted and treated with NPs that carry single or multiple therapeutic agents.115 He et al developed an amphiphilic polymer-lipid nanocarrier system that could deliver DTX to TNBCBMs. Compared with an equivalent dose of a clinical preparation of DTX, DTX-NPs showed rapid uptake by TNBC cells, elevated intracellular drug concentrations, prolonged drug circulation time, and increased brain bioavailability, which significantly inhibited BM growth and prolonged the survival time of patients. Importantly, these effects were not accompanied by histological changes in the main organs, including the lungs, liver, kidneys, and heart.116 Li et al constructed a PTX-loaded liposome co-modified with acid-cleavable folic acid (FA) and the BBB-transmigrating, cell-penetrating dNP2 peptide (cFd-Lip/PTX) to synergically improve BBB penetration and the targeting of the tumor microenvironment (TME). The authors found that cFd-Lip was the sensitive to cleavage in the acidic TME, which maximized the function of both FA and the dNP2 peptide. This liposome allowed for deeper penetration and increased accumulation in primary breast cancer and sites of BM, thus helping to enhance anti-tumor activity. This cascade targeting strategy provides a feasible method for overcoming the TME and the BBB in primary breast cancer and associated BM.117 Zhang et al designed a multitarget drug delivery system consisting of a cyclic internalizing peptide (iRGD)-modified terpolymer-lipid hybrid nanoparticle system (TPLN) coloaded with DOX and mitomycin C (MMC) (iRGD-DMTPLN). Compared with untargeted DMTPLN or a free DOX/MMC combination, iRGD-DMTPLN treatment reduced the TNBCBM by 6-fold and 19-fold, respectively, and prolonged host median survival by 1.3-fold and 1.6-fold, respectively. Meanwhile, this nanosystem also reduced the cardiotoxicity associated with the DOX/MMC combination.118

Because many nanocarriers and targeting moieties can bind nonspecifically to tumor cells, as well as to extracellular and intravascular components, developing effective nanodrug preparations targeting tumor cells has always been challenging. The recently developed DART nanoparticles could effectively ameliorate this problem. PTX-DART nanoparticles could directly bind to fibroblast growth factor-inducible 14 (Fn14) that is highly expressed on the surface of TNBC cells in both primary TNBC and associated BM, and released a high concentration of PTX to kill the cancer cells while reducing the killing of normal cells.119

Nanotechnology has brought new opportunities for anti-TNBCBM precision therapy. The development of precision medicine, in combination with an in-depth understanding of TNBCBM-specific markers, will allow for more accurate identification of tumor proliferation and metastatic-related signaling pathways and the discovery of drug targets in CSCs. Novel TNBCBM drug delivery systems, which integrate nanotechnology and precision therapy, hold promise as a means of blocking BM occurrence and development.

BM is one of the main complications associated with TNBC and the most severe event threatening the survival of TNBC patients. However, there is no FDA-approved drug currently available for the treatment of TNBCBM. Consequently, there is a need for a comprehensive understanding of the biology of TNBCBM to allow the development new therapies. The unique biological characteristics of TNBC cells are conducive to brain invasion and metastasis, and the destruction of the BBB, the formation of highly permeable BTB, and changes in the CNS microenvironment all play a key role in the formation of TNBCBM. Although newly identified therapeutic targets and novel strategies have brought new hope to BM patients, more research is required to allow the development of effective and low-toxicity treatment regimens for TNBCBM patients. Future research directions may include (i) further investigation of the mechanisms underlying the development of TNBCBM, such as lipid metabolism in metastatic cells in the brain, BM-specific gene mutations, and changes in gene expression; (ii) developing novel therapeutic agents that can adequately penetrate the BBB and target the main steps of the metastatic cascade; (iii) conducting preclinical and clinical studies of targeted drugs to explore their mechanism-of-action, efficacy, and appropriate doses; (iv) identifying the high-risk factors for BM in TNBC patients and developing risk prediction tools. The emergence of modern precision medicine, in-depth knowledge of the biological behavior of TNBCBM and related signaling pathways, the selection of more accurate targeted therapies, and the development of more clinical trials, may in the future, lead to more precise and individualized treatment options for TNBCBM patients.

No applicable.

All authors made substantial contributions to conception and design, acquisition of data, or analysis and interpretation of data; took part in drafting the article or revising it critically for important intellectual content; agreed to submit to the current journal; gave final approval of the version to be published; and agree to be accountable for all aspects of the work.

This research was supported by grants from Jiangsu Provincial Key Discipline of Medicine (grant no. ZDXKA2016009 to J.F.).

The authors report no conflicts of interest in this work.

1. Siegel RL, Miller KD, Jemal A. Cancer Statistics 2017. Ca-Cancer J Clin. 2017;67(1):730. doi:10.3322/caac.21387

2. Anders C, Carey LA. Understanding and treating triple-negative breast cancer. Oncology (Williston Park). 2008;22(11):12331239;discussion 12391240, 1243.

3. Li XX, Yang J, Peng LM, et al. Triple-negative breast cancer has worse overall survival and cause-specific survival than non-triple-negative breast cancer. Breast Cancer Res Tr. 2017;161(2):279287. doi:10.1007/s10549-016-4059-6

4. Al-Mahmood S, Sapiezynski J, Garbuzenko OB, Minko T. Metastatic and triple-negative breast cancer: challenges and treatment options. Drug Deliv Transl Res. 2018;8(5):14831507.

5. Brosnan EM, Anders CK. Understanding patterns of brain metastasis in breast cancer and designing rational therapeutic strategies. Ann Transl Med. 2018;6(9):163. doi:10.21037/atm.2018.04.35

6. Ostrom QT, Wright CH, Barnholtz-Sloan JS. Brain metastases: epidemiology. Handb Clin Neurol. 2018;149:2742.

7. Wanleenuwat P, Iwanowski P. Metastases to the central nervous system: molecular basis and clinical considerations. J Neurol Sci. 2020;412:116755. doi:10.1016/j.jns.2020.116755

8. Lin NU, Claus E, Sohl J, Razzak AR, Arnaout A, Winer EP. Sites of distant recurrence and clinical outcomes in patients with metastatic triple-negative breast cancer: high incidence of central nervous system metastases. Cancer. 2008;113(10):26382645. doi:10.1002/cncr.23930

9. Martin AM, Cagney DN, Catalano PJ, et al. Brain metastases in newly diagnosed breast cancer a population-based study. JAMA Oncol. 2017;3(8):10691077. doi:10.1001/jamaoncol.2017.0001

10. Kim YJ, Kim JS, Kim IA. Molecular subtype predicts incidence and prognosis of brain metastasis from breast cancer in SEER database. J Cancer Res Clin. 2018;144(9):18031816. doi:10.1007/s00432-018-2697-2

11. Duchnowska R, Jarzab M, Zebracka-Gala J, et al. Brain metastasis prediction by transcriptomic profiling in triple-negative breast cancer. Clin Breast Cancer. 2017;17(2):E65E75. doi:10.1016/j.clbc.2016.08.008

12. Yao Y, Chu Y, Xu B, Hu Q, Song Q. Risk factors for distant metastasis of patients with primary triple-negative breast cancer. Biosci Rep. 2019;39:6. doi:10.1042/BSR20190288

13. Kaidar-Person O, Meattini I, Jain P, et al. Discrepancies between biomarkers of primary breast cancer and subsequent brain metastases: an international multicenter study. Breast Cancer Res Tr. 2018;167(2):479483. doi:10.1007/s10549-017-4526-8

14. Wang Z, Zhang X, Shen P, Loggie BW, Chang Y, Deuel TF. Identification, cloning, and expression of human estrogen receptor-alpha36, a novel variant of human estrogen receptor-alpha66. Biochem Biophys Res Commun. 2005;336(4):10231027. doi:10.1016/j.bbrc.2005.08.226

15. Wang Z, Zhang X, Shen P, Loggie BW, Chang Y, Deuel TF. A variant of estrogen receptor-{alpha}, hER-{alpha}36: transduction of estrogen- and antiestrogen-dependent membrane-initiated mitogenic signaling. Proc Natl Acad Sci U S A. 2006;103(24):90639068. doi:10.1073/pnas.0603339103

16. Zhang XT, Kang LG, Ding L, Vranic S, Gatalica Z, Wang ZY. A positive feedback loop of ER-alpha36/EGFR promotes malignant growth of ER-negative breast cancer cells. Oncogene. 2011;30(7):770780. doi:10.1038/onc.2010.458

17. Zhang X, Meng J, Wang ZY. A switch role of Src in the biphasic EGF signaling of ER-negative breast cancer cells. PLoS One. 2012;7(8):e41613. doi:10.1371/journal.pone.0041613

18. Zhang XT, Ding L, Kang LG, Wang ZY. Involvement of ER-alpha36, Src, EGFR and STAT5 in the biphasic estrogen signaling of ER-negative breast cancer cells. Oncol Rep. 2012;27(6):20572065. doi:10.3892/or.2012.1722

19. Ma F, Li H, Wang H, et al. Enriched CD44(+)/CD24(-) population drives the aggressive phenotypes presented in triple-negative breast cancer (TNBC). Cancer Lett. 2014;353(2):153159. doi:10.1016/j.canlet.2014.06.022

20. Li H, Ma F, Wang H, et al. Stem cell marker aldehyde dehydrogenase 1 (ALDH1)-expressing cells are enriched in triple-negative breast cancer. Int J Biol Markers. 2013;28(4):e357364. doi:10.5301/JBM.5000048

21. Li W, Ma H, Zhang J, Zhu L, Wang C, Yang Y. Unraveling the roles of CD44/CD24 and ALDH1 as cancer stem cell markers in tumorigenesis and metastasis. Sci Rep. 2017;7(1):13856. doi:10.1038/s41598-017-14364-2

22. Liu P, Tang H, Song C, et al. SOX2 promotes cell proliferation and metastasis in triple negative breast cancer. Front Pharmacol. 2018;9:942. doi:10.3389/fphar.2018.00942

23. Horiuchi D, Kusdra L, Huskey NE, et al. MYC pathway activation in triple-negative breast cancer is synthetic lethal with CDK inhibition. J Exp Med. 2012;209(4):679696. doi:10.1084/jem.20111512

24. Park SY, Choi JH, Nam JS. Targeting cancer stem cells in triple-negative breast cancer. Cancers (Basel). 2019;11:7. doi:10.3390/cancers11070965

25. Yang J, Mani SA, Donaher JL, et al. Twist, a master regulator of morphogenesis, plays an essential role in tumor metastasis. Cell. 2004;117(7):927939. doi:10.1016/j.cell.2004.06.006

26. Yu M, Bardia A, Wittner B, et al. Circulating breast tumor cells exhibit dynamic changes in epithelial and mesenchymal composition. Science. 2013;339(6119):580584. doi:10.1126/science.1228522

27. Fischer KR, Altorki NK, Mittal V, Gao DC. Upholding a role for EMT in breast cancer metastasis Reply. Nature. 2017;547(7661):E5E6. doi:10.1038/nature22817

28. Chaffer CL, Marjanovic ND, Lee T, et al. Poised Chromatin at the ZEB1 promoter enables breast cancer cell plasticity and enhances tumorigenicity. Cell. 2013;154(1):6174. doi:10.1016/j.cell.2013.06.005

29. Karihtala P, Auvinen P, Kauppila S, Haapasaari KM, Jukkola-Vuorinen A, Soini Y. Vimentin, zeb1 and Sip1 are up-regulated in triple-negative and basal-like breast cancers: association with an aggressive tumour phenotype. Breast Cancer Res Tr. 2013;138(1):8190. doi:10.1007/s10549-013-2442-0

30. Liu T, Zhang XY, Shang M, et al. Dysregulated expression of Slug, vimentin, and E-cadherin correlates with poor clinical outcome in patients with basal-like breast cancer. J Surg Oncol. 2013;107(2):188194. doi:10.1002/jso.23240

31. Yamashita N, Tokunaga E, Kitao H, et al. Vimentin as a poor prognostic factor for triple-negative breast cancer. J Cancer Res Clin. 2013;139(5):739746. doi:10.1007/s00432-013-1376-6

32. Khaled N, Bidet Y. New insights into the implication of epigenetic alterations in the EMT of triple negative breast cancer. Cancers. 2019;11:4. doi:10.3390/cancers11040559

33. Bowers LW, Rossi EL, McDonell SB, et al. Leptin signaling mediates obesity-associated CSC enrichment and EMT in preclinical TNBC models. Mol Cancer Res. 2018;16(5):869879. doi:10.1158/1541-7786.MCR-17-0508

34. Nalla LV, Kalia K, Khairnar A. Self-renewal signaling pathways in breast cancer stem cells. Int J Biochem Cell B. 2019;107:140153. doi:10.1016/j.biocel.2018.12.017

35. Minakshi R, Rahman S, Jan AT, Archana A, Kim J. Implications of aging and the endoplasmic reticulum unfolded protein response on the molecular modality of breast cancer. Exp Mol Med. 2017;49(11):49. doi:10.1038/emm.2017.215

36. Mittal D, Sinha D, Barkauskas D, et al. Adenosine 2B receptor expression on cancer cells promotes metastasis. Cancer Res. 2016;76(15):43724382. doi:10.1158/0008-5472.CAN-16-0544

37. Fabbri F, Salvi S, Bravaccini S. Know your enemy: genetics, aging, exposomic and inflammation in the war against triple negative breast cancer. Semin Cancer Biol. 2019;60:285293. doi:10.1016/j.semcancer.2019.10.015

38. Abbott NJ, Patabendige AAK, Dolman DEM, Yusof SR, Begley DJ. Structure and function of the blood-brain barrier. Neurobiol Dis. 2010;37(1):1325. doi:10.1016/j.nbd.2009.07.030

39. Villasenor R, Lampe J, Schwaninger M, Collin L. Intracellular transport and regulation of transcytosis across the blood-brain barrier. Cell Mol Life Sci. 2019;76(6):10811092. doi:10.1007/s00018-018-2982-x

40. Wilhelm I, Molnar J, Fazakas C, Hasko J, Krizbai IA. Role of the blood-brain barrier in the formation of brain metastases. Int J Mol Sci. 2013;14(1):13831411. doi:10.3390/ijms14011383

41. Mills MN, Figura NB, Arrington JA, et al. Management of brain metastases in breast cancer: a review of current practices and emerging treatments. Breast Cancer Res Treat. 2020;180(2):279300. doi:10.1007/s10549-020-05552-2

42. Kienast Y, von Baumgarten L, Fuhrmann M, et al. Real-time imaging reveals the single steps of brain metastasis formation. Nat Med. 2010;16(1):116U157. doi:10.1038/nm.2072

43. Blecharz KG, Colla R, Rohde V, Vajkoczy P. Control of the blood-brain barrier function in cancer cell metastasis. Biol Cell. 2015;107(10):342371.

44. Avraham HK, Jiang SX, Fu YG, Nakshatri H, Ovadia H, Avraham S. Angiopoietin-2 mediates blood-brain barrier impairment and colonization of triple-negative breast cancer cells in brain. J Pathol. 2014;232(3):369381. doi:10.1002/path.4304

45. Yonemori K, Tsuta K, Ono M, et al. Disruption of the blood brain barrier by brain metastases of triple-negative and basal-type breast cancer but not HER2/neu-Positive Breast Cancer. Cancer. 2010;116(2):302308. doi:10.1002/cncr.24735

46. Mustafa DAM, Pedrosa RMSM, Smid M, et al. T lymphocytes facilitate brain metastasis of breast cancer by inducing Guanylate-Binding Protein 1 expression. Acta Neuropathol. 2018;135(4):581599. doi:10.1007/s00401-018-1806-2

47. Pedersen MH, Hood BL, Beck HC, Conrads TP, Ditzel HJ, Leth-Larsen R. Downregulation of antigen presentation-associated pathway proteins is linked to poor outcome in triple-negative breast cancer patient tumors. Oncoimmunology. 2017;6:5. doi:10.1080/2162402X.2017.1305531

48. Logsdon AF, Erickson MA, Rhea EM, Salameh TS, Banks WA. Gut reactions: how the blood-brain barrier connects the microbiome and the brain. Exp Biol Med. 2018;243(2):159165. doi:10.1177/1535370217743766

49. Liebner S, Dijkhuizen RM, Reiss Y, Plate KH, Agalliu D, Constantin G. Functional morphology of the blood-brain barrier in health and disease. Acta Neuropathol. 2018;135(3):311336. doi:10.1007/s00401-018-1815-1

50. Arvanitis CD, Askoxylakis V, Guo YT, et al. Mechanisms of enhanced drug delivery in brain metastases with focused ultrasound-induced blood-tumor barrier disruption. P Natl Acad Sci USA. 2018;115(37):E8717E8726.

51. Lockman PR, Mittapalli RK, Taskar KS, et al. Heterogeneous blood-tumor barrier permeability determines drug efficacy in experimental brain metastases of breast cancer. Clin Cancer Res. 2010;16(23):56645678. doi:10.1158/1078-0432.CCR-10-1564

Read more:
[Full text] Understanding Patterns of Brain Metastasis in Triple-Negative Breast C | OTT - Dove Medical Press

News breaks in the cancer arena all the time. Sometimes its big like word that a breakthrough drug has increased survival for a hard-to-treat cancer. Sometimes its smaller. Any of it may matter to you and your family as you navigate your cancer journey. We do our best to keep you up-to-date with a monthly roundup of some of the most significant recent cancer news.

Whats New The incidence of esophageal adenocarcinoma (EAC) is on the rise in adults under age 50, and younger adults are more likely to be diagnosed with advanced disease, according to a study published December 16 in Cancer Epidemiology, Biomarkers & Prevention, a journal of the American Association for Cancer Research.

Research Details Researchers from Mayo Clinic in Rochester, Minnesota, analyzed data from 34,443 cases of esophageal cancer diagnosed between 1975 and 2015. They calculated incidence rates for three age groups: under age 50; 50 to 69; and 70 and over. The study showed that rates of the disease increased over time in all age groups, but that the biggest increase was among patients 50 and younger, with an average increase of 2.9 percent per year between 1975 and 2015. Younger patients were also more likely to be diagnosed with advanced stage disease, with 84.9 percent of those under 50 diagnosed with advanced disease compared with 67.3 percent of those 50 or older.

Why It MattersPatients should be aware of risk factors and symptoms of esophageal cancer, including difficulty swallowing, chest discomfort, and unintended weight loss, say the authors of the study. People with long-term acid reflux and people with a family history of the disease should discuss screening for esophageal cancer with their physicians. Early diagnosis of the disease correlates to better outcomes, the authors said. Our findings suggest that physicians should have a low threshold of suspicion for patients who present with dysphagia (difficulty swallowing), said study coauthor Don C. Codipilly, MD, a gastroenterology fellow at the Mayo Clinic.

RELATED: Cancer News Digest: The Latest Developments in Cancer Research and Treatment for October 2020

Whats NewBlack women with ovarian cancer who contracted COVID-19 were much more likely to become seriously ill compared with non-Black women with ovarian cancer who caught the virus, according to astudy published December 9 in the journal Cancer.

Research DetailsThe study examined 193 patients with ovarian cancer treated at eight New York City hospitals. Just over 71 percent of the Black women with COVID-19 required hospitalization compared with 46 percent of non-Black patients. Of the 34 patients who died from COVID-19, 41.2 percent of them were Black.

Why It Matters The study analysis suggested that Black patients with COVID-19 had a higher prevalence of other health problems that contributed to their worsening COVID-19 infection. "The underlying causes of racial disparities are multifactorial and include limited access to healthcare, [and] social determinants of health, racism, and discrimination. The COVID-19 pandemic has only heightened these and brought awareness," said senior author Bhavana Pothuri, MD, of NYU Langone Health in New York City.

RELATED: American Cancer Society Releases New Cervical Cancer Screening Guidelines

Whats NewPeople with small, low-risk thyroid cancers may be able to choose active surveillance monitoring the tumors size and skip treatment, according to a study published in November 2020 in JAMA Otolaryngology-Head & Neck Surgery.

Research Details The study, from researchers at The Dartmouth Institute and Kuma Hospital in Japan, looked at 1,179 patients at Kuma Hospital between 2005 and 2017 who were part of an active surveillance program. The study found that 91 percent of the patients adhered to the active surveillance protocol, which included undergoing regular ultrasound exams. Only 4.5 percent of the patients chose surgery after two years.

Why It MattersThe rate of small papillary thyroid cancers (tumors less than 2 centimeters in size) has risen sharply around the world in the past three decades. Some experts suggest that small thyroid cancer tumors are being detected more now due to enhanced imaging and, if not detected, would likely never have been caught or caused the patient problems. This study is the first to analyze the active surveillance approach for these low-risk tumors.

RELATED: Everyday Healths Prostate Cancer Awareness Month Twitter Chat: Heres What You Missed

Whats NewPeople with head and neck cancer have a low risk of contracting COVID-19 following surgery, according to research published December 21 in the journalCancer.

Research DetailsResearchers in the United Kingdom analyzed data from1,137 patients in 26 countries with a diagnosis of cancer of the oral cavity or thyroid who underwent surgery during the pandemic. The death rate within 30 days after surgery was 1.2 percent, a rate that would be normally expected in this patient population, without a pandemic. Three percent of the patients tested positive for COVID-19 within 30 days of surgery, and of those 44.8 percent developed severe respiratory complications. Patients were more likely to test positive for COVID-19 if they lived in communities with high levels of COVID-19, had oral tumors, and had received a tracheostomy (an opening created in the neck to facilitate placing a tube into the windpipe).

Why It Matters The study clarifies the COVID-19 risk in a vulnerable patient group. Since the start of the pandemic, physicians have learned more about reducing the risk of infection in cancer patients. "In head and neck cancer surgery the cure is dependent on surgery, but there was great concern about spreading infection from aerosol-generating procedures in the airway," said corresponding author Richard J. Shaw, MD, of the University of Liverpool Cancer Research Centre in England. The early consensus was that head and neck surgery was very risky for patients, particularly less fit or elderly patients, or those who required complex procedures or reconstructive surgery. Our data is reassuring in this regard, showing that there is no additional risk of COVID-19 for these groups."

RELATED: 8 Biggest COVID Vaccine Myths

Whats NewAdding the drug Venclexta (venetoclax) to standard therapies is safe for some high-risk patients with myeloid blood cancers that have relapsed after initial treatment, such as acute myeloid leukemia (AML) and myelodysplastic syndrome (MDS), according to research presented December 7 at the 62nd American Society of Hematology (ASH) Annual Meeting.

Research Details Researchers from Dana-Farber Cancer Institute reported on a study examining the use of Venclexta with standard therapy. Venclexta, approved to treat some types of blood and lymph cancers, was added to a standard pretransplant chemotherapy regimen in 22 patients with high-risk disease and who then underwent stem cell transplantation. The study found no serious toxicities with the addition of Venclexta. At the time of the data analysis, 7 of the 22 patients had died, but the six-month overall survival for the group was 84 percent.

Why It Matters Treatment options are needed for patients with advanced myeloid blood cancers who relapse after stem cell transplantation. The study tests the idea that adding Venclexta to chemotherapy will reduce the risk of relapse. The addition of the medication demonstrates promising clinical activity supporting further evaluation for high-risk disease features, said the presenting author, Jacqueline Garcia, MD.

RELATED: Cancer News Digest: The Latest Developments in Cancer Research and Treatment for August 2020

Read more:
Cancer News: The Latest Developments in Cancer Research and Treatment - Everyday Health

This article was originally published here

Adv Exp Med Biol. 2021 Jan 1. doi: 10.1007/5584_2020_613. Online ahead of print.

ABSTRACT

COVID-19 is the current day pandemic that has claimed around 1,054,604 lives globally till date. Moreover, the number of deaths is going to increase over the next few months until the pandemic comes to an end, and a second wave has also been reported in few countries. Most interestingly, the death rate among certain populations from the same COVID-19 infection is highly variable. For instance, the European populations show a very high death rate, in contrast to the populations from Chinese ethnicities. Amongst all the closed cases with an outcome (total recovered + total died), the death rate in Italy is 13%, Iran is 6%, China is 5%, Brazil is 3%, The United States of America is 2%, India 2%, Israel is 1% as of October 08, 2020. However, the percentage was higher during the early phase of the pandemic. Moreover, the global death rate amongst all the patients with an outcome is 4%. Here we have reviewed virus-transmitted various respiratory tract infections and postulated a better understanding of SARS-CoV2 using lung stem cell organoids in vitro. Hence, here we propose the strategies of understanding first the infectivity/severity ratio of COVID-19 infections using various ethnicity originated induced pluripotent stem cell-derived lung stem cell organoids in vitro. The greater the infectivity to severity ratio, the better the disease outcome with the value of 1 being the worst disease outcome. This strategy will be useful for understanding the infectivity/severity ratio of virus induced respiratory tract infections for a possible betterment of community-based disease management. Also, such a strategy will be useful for screening the effect of various antiviral drugs/repurposed drugs for their efficacy in vitro.

PMID:33385178 | DOI:10.1007/5584_2020_613

Continue reading here:
Induced Pluripotent Stem Cell Derived Human Lung Organoids to Map and Treat the SARS-CoV2 Infections In Vitro - DocWire News

Indore: After being jolted by governments decision to shift State Organ and Tissue Transplant Organisation (SOTTO) to Bhopal, Indore Organ Donation Society headed by divisional commissioner and MGM Medical College dean have restarted the organ donation drive in the city as an attempt to bring back the centre in city.

They have asked private hospitals to inform them about the brain stem cell death patients. Moreover, hospitals have also been directed to send monthly data on deaths that took place in the ICU of their hospitals in given format, which mentioned the reason of death, brain stem cell death declaration, and counselling of family members.

We have taken measures to restart organ donation drive in the city, which has hit Covid hurdle. We have asked hospitals to immediately inform about brain stem cell death of patients so that their families can be counselled and lives of others can be saved, MGM Medical College dean Dr Sanjay Dixit said.

Read more:
Madhya Pradesh: Organ donation drive pushed further in Indore, hospitals directed to inform about brain stem cell death patients immediately - Free...

Indore:

After being jolted by the governments decision to shift the State Organ and Tissue Transplant Organisation (SOTTO) to Bhopal, Indore Organ Donation Society and the appropriate authorities have started initiatives to restart the organ donation drive as an attempt to bring back the centre to the city.

Following the same, Dean and Appropriate Authority of Mahatma Gandhi Memorial Medical College has directed all the private hospitals to necessarily inform about the brain stem cell death patients.

Moreover, hospitals have also been directed to send monthly data on the deaths that take place in the ICU of their hospitals, brain stem cell death declaration, and counselling of the family members.

Instructions have been passed to 35 hospitals of the city including Bombay Hospital, Apollo Hospital, Medanta Hospital, CHL Hospital, Choithram Hospital, and others.

Hospitals have to send the signed scanned copy and soft copy in a given format on the first week of every month so that the authorities can learn about the deaths in ICUs of hospitals and identify the reason as to why brain stem cell death couldnt be identified or informed.

Yes, we have been taking various measures to restart the organ donation drive in the city which has hit a hurdle due to the Covid crisis. We have asked the hospitals to immediately inform about the brain stem cell death of patients so that their families can be counselled and the lives of others could be saved, Dean of MGM Medical College Dr Sanjay Dixit said.

Meanwhile, various organisations and NGOs continued their protest against the government decision of shifting SOTTO to Bhopal from Indore and said that Indore is leading city in Central India and shifting SOTTO would hit Indores ongoing drive for organ donation.

As many as 39 green corridors were formed in the city since 2015 to transport vital organs in the city and to different states to save the lives of many people.

Read the original:
Indore: In a bid to push organ donation, h ospitals directed to intimate about brain stem cell deaths - Free Press Journal

One hundred lives or more, its hard to say how many people have been saved but one "deadly drug cell" is no longer in operation in Warren, according to police.

Warren Police Commissioner William Dwyer detailed on Wednesday the success by his special investigations unit in taking down key players in a conspiracy that allegedly involved the sale of heroin laced with fentanyl, believed to be responsible for at least three deaths in Warren this past year.

Dwyer stated in a news release that early morning raids were conducted by Warren police units at two locations in Detroit, drugs were seized and arrests were made.

Three Detroit men have been arraigned and are jailed in lieu of bonds of $250,000 to $350,000 including: Jermaine Tate, 38, Nathaniel Clark, 32 and Terry Jamal Gaskins, 34. Each have been charged with conducting criminal enterprise, a drug trafficking organization; three counts of delivery/manufacture of fentanyl, and three counts of conspiracy to conduct the delivery/manufacture of fentanyl.

Also charged in a not-in-custody warrant is Isaac Lee Bannerman, 34, of Detroit.

Each offense is a felony punishable by up to 20 years in prison.

"These arrests stem from the Warren Police Department's Operation SNOW (Stopping Narcotic Overdoses in Warren)," Dwyer said, of the group that began its investigation in November following the death of a 47-year-old Warren resident.

"We are anticipating more charges and arrests in the near future," Dwyer said. "We believe this group is a cell in a major organization that is providing fentanyl to those addicted not only in Warren but also throughout the rest of Macomb County, as well as Wayne, St. Clair and Lapeer counties."

Among the leaders Dwyer singled out for their tenacity and dedication to the investigation were: Lt. Matthew Dillenbeck, Sgt. Steve Showers; and Detectives Craig Bankowski and Todd Murray.

The investigation is one of many efforts to combat the rising deaths related to drug abuse.

Overdose drug deaths have been a rising problem across the country, Dwyer said. In 2019, there were 72,000 overdose deaths nationwide and in the last year have increased by 13% he said. Michigan averages 26.6 overdose deaths per 100,000 people and deaths from illicit drugs like fentanyl remain higher than death totals for car accidents, gun violence and AIDS, Dwyer said.

Warren Police Commissioner William Dwyer

MACOMB DAILY FILE PHOTO

Fentanyl, according to the National Institute on Drug Abuse, is a powerful synthetic opioid that is similar to morphine but is 50 to 100 times more potent. It is a prescription drug given to patients for pain, particularly after surgery.

"In Warren alone for the year 2020, we have had 296 overdoses, up from 249 in 2019," Dwyer said. "Sadly, the amount of overdose deaths has increased from 29 reported in 2019 to 55 overdose deaths in 2020. This represents an 89.6% increase."

Applauding the success of the month-long investigation was Warren Mayor Jim Fouts.

"It has been a priority of my administration to work on eliminating drug overdoses and holding those who distribute these toxins throughout our city accountable," Fouts said.

Commissioner Dwyer also applauded Macomb County Assistant Prosecutor Dena Keller for demonstrating "excellent professionalism and dedication in her work assisting the Warren police department in this investigation."

READ MORE

Macomb County medical board: EMS opioids overdose treatment up during COVID-19

Continued here:
Deadly drug cell shattered by Warren police narcotics investigation - The Macomb Daily

Jersey City sports suffered a big loss when Ellen Zadroga (pictured here) passed away after a battle with cancer two weeks ago

Jersey City sports suffered a big loss when Ellen Zadroga (pictured here) passed away after a battle with cancer two weeks ago

When long-time Jersey City resident, teacher and athletic advocate Ellen Zadroga was diagnosed with leukemia in 1997, she basically laughed at her doctors.

Her doctors gave her six months to live, said her daughter Kristen Zadroga-Hart, the athletic director at McNair Academic. And that was 23 years ago.

Unfortunately, Ellens time on earth came to an end a few weeks ago, when her suffering finally ended. Ellen died Dec. 19, just two days before her 78th birthday.

For many years, Ellen Zadroga, who was born into the vast and beloved Finn family of Jersey City, was a school teacher at P.S. 8 in Jersey City.

But she was also always involved in athletics.

When she was a teacher at P.S. 8, she started the intramural program there, her daughter Kristen said. She always wanted to get kids involved in sports. It became a big part of our family. She wanted to make sure that it was possible for kids to play sports.

So she did. She campaigned for athletic events and facilities, raising money to help countless organizations in sports.

She was always raising money, her daughter said.

A good portion of Ellens time was her devotion was to her large family.

I think her devotion to her family was her Number One priority, Zadroga-Hart said. But it wasnt just blood relations. If you were her friend, then you were a friend for life. I cant begin to count how many people who told me that my mother changed their lives. They said, Your mother went out of her way to help me. If she could help, she would give whatever they needed.

When Dan Finn, Ellens nephew, was hit by a car in Myrtle Beach, S.C. in 2004, an accident that ended the great St. Peters Prep athletes life, his organs were harvested. Sure enough, his aunt Ellen, who was already diagnosed with leukemia and in dire need of a kidney transplant, was a match with her nephew who had just passed on.

We knew the prognosis was not good with Dan, said Ed Finn, Ellens brother and Dans father. We said to the nurses that if Dan doesnt come out of this, then we wanted a promise to have Ellen get Dans kidneys.

This came after stem cell transplant surgery on Ellen did not succeed.

But Dan Finn gave his aunt the gift of life and Ellen Zadroga most certainly did live life to the fullest every single day after the transplant surgery.

I think she held on because of Danny, Kristen Zadroga-Hart said. She didnt want to waste the gift of life that Danny gave her with his kidney.

I think the relationship between Ellen and myself grew deeper after that, said Ed Finn, a long-time respected teacher and basketball official who runs the Dan Finn Classic every year in honor of his deceased son.

But in the last few months, Ellens health deteriorated. She had to endure the tragic death of her grandson, Richie R.J. Zadroga, in October.

And she eventually passed away, her fight was over a few weeks ago.

When I got the call from Tara [Ellens other daughter] that Ellen had passed, I was extremely sad for about 10 minutes, Ed Finn said. And then I realized how great of a life she had. She never looked away from anyone. If she could help someone, she was always there. I never had to ask her for anything. If there was something I needed, she knew about it before I did.

There arent words to describe the strength she had, Kristen Zadroga-Hart said. She battled leukemia, stem cell transplant, kidney transplant. When she was in so much pain, she never complained. She said that she was happy to live another day. We told her that there were people praying for her and she said that she didnt need the prayers. She said, Pray for everyone around me.

Kristen Zadroga-Hart said that she had an idea of how much her mother was beloved.

But a lot of it was a little overwhelming, Zadroga-Hart said. It was just the amount of people who were saying such great things about her, seeing her former students coming up to me and saying nice things. I think she had a life well lived. And she lived it for others.

From a personal standpoint, I always loved to see the interaction between Ellen and our mutual friend, Ed Faa Ford, when Ellen was an assistant superintendent of schools and part of her responsibility was monitoring the Board of Educations main playing field, namely Caven Point Cochrane Stadium in a complex that now bears the name of Ed Faa Ford.

She had a close relationship with Faa, Kristen Zadroga-Hart said.

That they did and it was a joy to see the two go at it with each other. Maybe that interaction is continuing now somewhere up there. God bless Ellen. She will most certainly be missed by many

Former Lincoln High School standout Frank Darby, a standout wide receiver at Arizona State, has declared his intentions to forego his final year of college eligibility and make himself eligible for the NFL Draft this spring.

Darby battled injuries this season and caught only six passes, one for a touchdown. But Darby shapes up to be a strong mid-round selection in the draft with a strong chance to be playing in the NFL come September

Major correction: Last week, when we listed the top 10 sports stories, we mentioned all the Hudson County sports legends that passed away in 2020.

One glaring omission off the list of great we lost was former New Jersey City University athletic director Alice Schmidt DeFazio.

A member of the Hudson County Sports Hall of Fame, Alice was a great player in her heyday, playing for that great Montclair State College team that featured other Hudson County women and went to the NCAA Final Four.

Alice then became a successful coach on the high school and collegiate level, eventually getting elevated to the position of athletic director at NJCU in 2007. She lost her life to a battle with pancreatic cancer, the same hideous disease that took the life of her Hall of Fame coaching husband Bill in 2010. Alice died last February and certainly deserved her spot of distinction with the list of people we mentioned.

My sincere apologies go out to all members of the Schmidt and DeFazio families for the unfortunate omission

And perhaps the best news of all, Gov. Phil Murphy lifted the ban on indoor sports, so it means that the winter sports seasons can move forward as planned later this month. The seasons will begin with hockey later this week, but basketball practices can begin with the season to tip off by the end of January. Thats exciting news for everyone involved in New Jersey sports. Jim Hague

Jim Hague can be reached via e-mail at OGSMAR@aol.com

Read the rest here:
TASTY TIDBITS - The Hudson Reporter

Following the harassment of Christian Cooper in Central Park in May 2020, Black birders created #BlackBirdersWeek to celebrate Black nature enthusiasts and highlight their belonging in outdoor spaces. Since then, dozens of campaigns have emerged to amplify and appreciate Black academics, scientists, and naturalists.

Next up is #BlackInMarineScienceWeek, running from November 29th to December 5th.Led by founder Dr. Tiara Moore and organizers Amani Webber-Schultz, Dr. Camille Gaynus, Carlee Jackson, Al Troutman, Jasmin Graham, Jeanette Davis, Kris Howard, Leslie Townsell, Kaylee Arnold, and Jaida Elcock, this week represents an opportunity for community building and improved representation.

There are few Black folks in ecology and even fewer in marine ecology, says Arnold, a science communicator and disease ecologist. The network that Ive gained through organizing this week is phenomenal. Meeting other Black marine scientists and showing that to the world, especially young Black folks, is a way to say we exist, were here. We have a full day dedicated to young kids, which is unique and exciting.

The organizers hope that the week will help normalize Black folks doing marine research, inspire younger generations, and remind everyone to check their preconceived notions.

"When I say I study sharks people seem concerned about my swimming or my hair, [and] sometimes respond with 'Oh, thats super interesting'... I dont know if that's because it's unusual for people to study sharks or because Im Black and I study sharks, recalls Elcock, an elasmobranch movement ecologist, science communicator, and co-founder of Minorities in Shark Science. Science is for everybody. People say there isn't diversity because [Black] people arent interested... thats clearly not true theres a whole week dedicated [to it]."

Discussion this week will address the fact that exclusion, not lack of interest, led to todays lack of representation. Centuries of segregation and underinvestment in Black neighborhood pools led to, and are perpetuated by, these incorrect and harmful ideas.

My grandparents and my mom said there were just no pools for her to go to... I had a very different experience. Despite people trying to push us out of the water and science, we persevered, and now we get to break down those stereotypes, notes Arnold.

Black in Marine Science Week is here to do just that, showcasing organizers and participants from every imaginable marine science niche, all shaping how society views the oceans and its inhabitants.

There's more Black folks than even we know and are showcasing. I hope that if the media picks up on the number of us as well, and has better representation. Seminar series are extremely white, and now you have a resource of people you can invite instead, emphasizes Arnold, pointing to the necessity of non-Black marine scientists to step up and ensure representation continues beyond this joyous and educational week.

Continued here:
Scientists have restored youth to aging eyes in mice - Massive Science

Dec. 17, 2020 08:30 UTC

GALWAY, Ireland, & SAN DIEGO, Calif.--(BUSINESS WIRE)-- ONK Therapeutics Ltd, an innovative natural killer (NK) cell therapy company, today announced that it has secured three new exclusive option license agreements which strengthen its off-the-shelf, dual-targeted natural killer (NK) cell therapy platform and extend its pre-clinical pipeline to four programs across both hematological and solid tumors.

The first option agreement, with Cellerant Therapeutics, gives exclusive rights to a humanized CLEC12A scFv binder. CLEC12A is strongly expressed by blasts in the majority of AML patients. The option to license has enabled ONK to expand its pre-clinical product portfolio, launching a fourth program (ONKT104). This dual-targeted approach combines the CLEC12A CAR with a TNF-related apoptosis-inducing ligand variant (TRAILv) targeting death receptor 4 (DR4).

While expressed on leukemic stem cells, CLEC12A is absent from normal hematopoietic stem cells and we thus expect that our dual-targeted NK cell therapy approach should enable safe targeting, with a reduced risk of prolonged aplasia in AML, said Prof Michael ODwyer MD, ONK Therapeutics co-founder, and CSO.

The second agreement in-licenses a humanized, tumor-specific antibody targeting an aberrantly glycosylated tumor-associated form of MUC1 (TA-MUC1) from Glycotope GmbH. Multiple solid tumor types express the mucin MUC1, including non-small cell lung cancer, breast cancer, and ovarian cancer. This antibody will be integrated into ONKs pre-clinical program ONKT103, for solid tumors.

Non-selective targeting of MUC1 could be problematic since the target is also expressed by healthy tissues, but ODwyer explains how ONKs dual-targeted approach can be used to address this. We have designed a CAR tailored to the glycosylation pattern distinct to tumor-associated MUC1 with specific recognition of the carbohydrate antigens Tn and T on MUC1, the expression of which is restricted to cancer cells. Glycotope has identified the glycosylation pattern as a way to unlock the potential of TA-MUC1 as a solid tumor target. ONK is thus set to bring the natural benefits of NK cells over T cells to bear on TA-MUC1, in a tumor-specific fashion, while also further boosting efficacy and countering resistance through the use of our TRAIL variant targeting DR5, he said.

ONKs unique platform approach combines the expression of a chimeric antigen receptor (CAR) and a high affinity, membrane-bound TRAILv. The incorporation of these two humanized scFvs has the potential to minimize the risk of immunogenicity in the allogeneic setting.

ONK is also exploring several innovative strategies to improve the homing of NK cells. This is an important consideration as ex-vivo expansion can lead to changes in chemokine receptor expression. Through this new license agreement with the NIH, ONK plans to enforce the expression of CCR7, which is downregulated on NK cell expansion. This may improve the homing of NK cells to lymph nodes and is expected to be particularly useful for ONKs off-the-shelf CD19 program targeting B cell lymphoma, ONKT101, which is partnered with Avectas.

ONK is making rapid progress since it announced its most recent financing in October. Chris Nowers, ex Kite Pharma Head of Europe, who joined at that time as Chief Executive Officer, said: The recent American Society of Hematology meeting highlighted the NK cell therapy area as offering great hope as the next generation of advanced cell therapies. We believe our best-in-class off-the-shelf, dual-targeted NK cell therapy platform has the potential to improve performance and overcome some of the shortcomings seen with earlier approaches. These new licensing activities strengthen and expand our programs and illustrate our ambition and strategy to become a leader in this exciting field.

The company recently expanded its operations into the USA, moving into JLABS @ San Diego, Johnson & Johnson Innovations flagship facility, at the heart of San Diegos precision medicine and cell therapy cluster. This represents a second facility that complements its main R&D team and operations in Galway, Ireland. The companys recruitment drive across both facilities has been rapid and the company continues to expand its capability in key areas, including NK cell biology, construct design, gene editing, and process development.

-Ends-

ONK Therapeutics http://www.onktherapeutics.com ONK Therapeutics Ltd is an innovative cell therapy company dedicated to developing the next generation of off-the-shelf, dual-targeted NK cell therapies targeting solid and hematological cancers.

The company was founded in 2015, by Prof. ODwyer MD, of NUI Galway, an expert in translational multiple myeloma research, the tumor microenvironment, and exploitation of NK cells as cellular immunotherapy. Its core proprietary platform is based on a dual-targeted NK cell expressing both a chimeric antigen receptor (CAR) targeting a known tumor antigen and a TNF-related apoptosis-inducing ligand variant (TRAILv) targeting the death receptor pathway (i.e. DR4 or DR5). This unique approach has the potential to enhance efficacy by addressing both intrinsic (e.g. CAR engagement of a tumor-specific antigen) and extrinsic (e.g. signaling through the death receptor pathway) apoptotic pathways and to reduce the susceptibility to possible target antigen escape through the engagement of tumor antigen-independent TRAILv.

Its pre-clinical pipeline comprises four programs;

In addition to the unique dual-targeted NK cell therapy platform, the company has a strong research focus on strategies to enhance homing and persistence, and overcome exhaustion, including the exploration of proprietary gene edits, such as the deletion of checkpoint inhibitory receptors in NK cells.

ONK Therapeutics is headquartered in the med-tech hub of Galway, Ireland, with a wholly-owned US subsidiary, ONK Therapeutics, Inc. based at JLabs @ San Diego. Shareholders include Acorn Bioventures, ALSHC (principally Seamus Mulligan), and Enterprise Ireland.

Follow us on Twitter and LinkedIn.

About Avectas - http://www.avectas.com Avectas is a cell engineering technology business that has developed a unique delivery platform, Solupore to enable the ex vivo manufacture of cell therapy products, which have high in-vivo functionality.

Glycotope http://www.glycotope.com Glycotope is a biotechnology company utilizing a proprietary technology platform to develop highly tumor-specific monoclonal antibodies called GlycoBodies. GlycoBodies bind to targets (GlycoTargets) tumor-specific carbohydrate structure dependent, enabling the development of highly-specific immunotherapies across a broad range of cancer indications. Glycotope has to date discovered in excess of 150 GlycoTargets with GlycoBodies against eight of these targets currently under development.

Each GlycoBody can be developed in an array of modalities with different modes of action providing a unique offering in the (immuno) oncology space. Currently, six clinical and pre-clinical programs based on the GlycoBody technology are under development by Glycotope or its licensing partners.

View source version on businesswire.com: https://www.businesswire.com/news/home/20201217005068/en/

Read more from the original source:
ONK Therapeutics Announces Three Exclusive Option License Agreements, Which Extend and Strengthen its Dual-Targeted NK Cell Therapy Pipeline -...

Kevin Croak, who taught acting at UW-Madison and appeared in independent films, was known for portraying bad guys.

He loved to play the mob bosses and the gangsters, from James Cagney onward, said Wil Loper, who directed Croak in several entries in the 48 Hour Film Project, an annual competition.

In real life, Croak was anything but a thug, said those who knew him. He was very gentle and mild-mannered, Loper said.

Croaks sister Cathy Braiman agreed. Its funny that the place he landed was this tough guy, she said. Its just the opposite of how I saw him.

Kevin Croak loved to play bad guys in films and dress up as a gangster, including during this photo shoot in 2014 on the UW-Madison campus.

Croak, 64, of Madison, died Nov. 28 from complications of COVID-19, according to what the medical examiner told the family, Braiman said. Single and living alone, Croak was found dead at his apartment a few days after calling in sick at his waiter job at Olive Garden near West Towne Mall. He had no underlying medical conditions that the family knew of, Braiman said.

He was the fourth of five children who grew up on Madisons West Side and attended Edgewood High School. His siblings left for Colorado, Maryland and Texas with one living in West Allis while Kevin stayed in the Madison area, where some cousins remain.

In the mid-80s, Jay Ekleberry hired Croak at Wisconsin Unions Mini Courses, now part of Wheelhouse Studios. Over more than 30 years, Croak taught basic acting techniques to hundreds of students in the five-week or six-week courses offered several times a year.

He really engaged people, Ekleberry said. He customized the class based on who was enrolled.

Loper directed Croak in six short films, including one for which Croak won a best actor award in 2016 in the 48 Hour Film Project in Milwaukee. When Loper would ask Croak to give his narration a bit of Rod Serling from Twilight Zone or Mr. Phelps from Mission Impossible, Croak knew exactly what he meant, Loper said.

On the next take, he would just nail it, Loper said. He lent gravitas towards it more so than caricature.

Kevin Croak is shown playing the lead role in "Gunner's Lament," a film shot in 2017 and directed by Jeremiah Zeier.

Croak was in nearly 400 films and more than 100 plays, including Madison Theatre Guild productions, according his undated online resume. I have made a career out of playing antagonists who ultimately come to an untimely end, including slippery politicians, smarmy lawyers, corrupt cops, mercurial mob mosses, sleazy nightclub owners, salacious Hollywood directors, eccentric professors and germaphobic pimps, the resume says.

Veronica Myers, who met Croak a few years ago while waitressing at Olive Garden, said she considered him her best friend.

Kevin had a way of interacting with people that made them feel like they were the only person in the world, she said.

See the article here:
Nearly 4500 people have died from COVID-19 in Wisconsin. Here are stories of some we've lost. - Madison.com

Following the harassment of Christian Cooper in Central Park in May 2020, Black birders created #BlackBirdersWeek to celebrate Black nature enthusiasts and highlight their belonging in outdoor spaces. Since then, dozens of campaigns have emerged to amplify and appreciate Black academics, scientists, and naturalists.

Next up is #BlackInMarineScienceWeek, running from November 29th to December 5th.Led by founder Dr. Tiara Moore and organizers Amani Webber-Schultz, Dr. Camille Gaynus, Carlee Jackson, Al Troutman, Jasmin Graham, Jeanette Davis, Kris Howard, Leslie Townsell, Kaylee Arnold, and Jaida Elcock, this week represents an opportunity for community building and improved representation.

There are few Black folks in ecology and even fewer in marine ecology, says Arnold, a science communicator and disease ecologist. The network that Ive gained through organizing this week is phenomenal. Meeting other Black marine scientists and showing that to the world, especially young Black folks, is a way to say we exist, were here. We have a full day dedicated to young kids, which is unique and exciting.

The organizers hope that the week will help normalize Black folks doing marine research, inspire younger generations, and remind everyone to check their preconceived notions.

"When I say I study sharks people seem concerned about my swimming or my hair, [and] sometimes respond with 'Oh, thats super interesting'... I dont know if that's because it's unusual for people to study sharks or because Im Black and I study sharks, recalls Elcock, an elasmobranch movement ecologist, science communicator, and co-founder of Minorities in Shark Science. Science is for everybody. People say there isn't diversity because [Black] people arent interested... thats clearly not true theres a whole week dedicated [to it]."

Discussion this week will address the fact that exclusion, not lack of interest, led to todays lack of representation. Centuries of segregation and underinvestment in Black neighborhood pools led to, and are perpetuated by, these incorrect and harmful ideas.

My grandparents and my mom said there were just no pools for her to go to... I had a very different experience. Despite people trying to push us out of the water and science, we persevered, and now we get to break down those stereotypes, notes Arnold.

Black in Marine Science Week is here to do just that, showcasing organizers and participants from every imaginable marine science niche, all shaping how society views the oceans and its inhabitants.

There's more Black folks than even we know and are showcasing. I hope that if the media picks up on the number of us as well, and has better representation. Seminar series are extremely white, and now you have a resource of people you can invite instead, emphasizes Arnold, pointing to the necessity of non-Black marine scientists to step up and ensure representation continues beyond this joyous and educational week.

See the rest here:
A new psychedelic drug gives psychiatric benefits without causing hallucinations - Massive Science