header logo image


Page 325«..1020..324325326327..330340..»

Turkey’s Covid death toll hits record for ninth day as it happened – The Guardian

December 3rd, 2020 11:52 pm

New Covid-19 infections in France stayed below 10,000 for the third day in a row on Tuesday, a sequence unseen since mid-September, and the number of people hospitalised resumed a downward trend.

The government has loosened its second national coronavirus lockdown, put in place on 30 October, by allowing all shops to reopen at the weekend.

The French president Emmanuel Macron said last week the lockdown could be lifted on 15 December if by then the number of new cases per day fell to 5,000 and the number of patients in intensive care declined to between 2,500 and 3,000.

Earlier in the day, Macron said that France should be in a position to embark on a broader Covid-19 vaccination campaign between April and June next year, after initially targeting a smaller group of people.

Health authorities reported 8,083 new cases over the past 24 hours on Tuesday, versus 4,005 on Monday and 9,784 on Sunday.

The seven-day moving average of daily new infections fell below 11,000 for the first time since 2 October, at 10,965, four times lower than the all-time high of 54,440 reached on 7 November.

The cumulative number of Covid-19 cases now totals 2,230,571, the fifth-highest in the world.

After increasing by 90 between Sunday and Monday, the number of people hospitalised for the disease fell by 619 to 27,639, below 28,000 for the first time since 4 November. The number of patients in ICUs declined by 146 to 3,605.

The number of people in France who have died from Covid-19 rose by 775 to 53,506, versus a rise of 406 on Monday. But the seven-day moving average of daily additional deaths stood at 467, below 500 for the first time in more than three weeks.

Read more here:
Turkey's Covid death toll hits record for ninth day as it happened - The Guardian

Read More...

Penn researchers find a way through the labyrinth keeping CAR-T from solid tumors – Endpoints News

December 3rd, 2020 11:52 pm

Blood vessels are supposed to act like trees, pumping in oxygen tissues need to grow and immune cells required to clear out pathogens. But in tumors, the forest can go a bit haywire. Vessels grow prodigiously and bulge and twist at abrupt points, making it difficult to even tell whats a vein and whats an artery. It starts to look less like a forest and more like a gnarled root floor. A disorganized labyrinth, one oncologist has called it.

For cancer, chaos is a virtue. That gnarled root floor insulates solid tumors from immune cells and, in recent years, has flustered drug developers best attempts at developing therapies meant to rev up the immune system and direct it toward the tumors.

Researchers at the University of Pennsylvania, however, think they may have stumbled onto a solution, a way of whipping the blood vessels back into proper shape. If it works, experts say, it could pave the way for CAR-T treatments that attack solid tumors and potentially improve the effectiveness for more traditional approaches, such as radiation and chemotherapy.

Its a really novel and potentially important approach, Patrick Wen, a neuro-oncologist at Dana-Farber who was not involved in the work, told Endpoints News. They really did good work. This is a very different way of improving immunotherapy.

Yi Fan, a radiation oncologist at Penns School of Medicine, has been working for the last few years to understand why the labyrinth appears in the first place. Researchers had previously circled in on the so-called growth factors that stimulate blood vessel formation. Attempts to block these factors, though, disappointed; Avastin, an antibody against the factor VEGF, became a blockbuster but has continually failed to improve survival on a range of malignancies.

Scientists would have to go more fundamental. In a pair of 2018 papers, Fan showed that part of the problem is a process called endothelial cell transformation. Cells lining the blood vessels around the tumor acquire stem cell-like properties that allow them to reproduce and expand rapidly, as stem cells do.

Theres a genetic reprogramming, Fan told Endpoints. Theyll become really aggressive.

But how did that reprogramming happen? If Fan could pin down the pathway, he figured he could then devise a way to block it. He started knocking out kinases the cellular engines that can drive epigenetic change, or reprogramming one by one in endothelial cells isolated from patients with an aggressive brain cancer called glioblastoma. Out of 518, 35 prevented transformation and one did so particularly well: PAK4.

Then they injected tumors into mice, some who had PAK4 and some who had the kinase genetically removed: Eighty percent of the mice who had PAK4 removed lived for 60 days, while all of the wild-type mice died within 40. Fans team also showed that T cells infiltrated the tumors more easily in the PAK4-less mice.

It was a fortuitous finding: Drug companies had developed several PAK inhibitors a decade ago, when kinase inhibitors were the flashiest thing in pharma. Many had been abandoned, but Karyopharm had recently brought a PAK4 blocker into Phase I.

To see whether drug developers could exploit this finding, Fan and his team removed T cells from mice and developed a CAR-T therapy to attack the tumors.

They gave mice three different regimens. The CAR-T therapy on its own failed to reduce tumor size, apparently unable to reach through the vessels. The Karyopharm drug also had little effect on its own. But combined, they managed to reduce tumor size by 80% after five days. They published the results in Nature Cancer this week.

It is a really eye-opening result, Fan said. I think we see something really dramatic.

That, of course, is just in mice, but Fan already has strong supporting evidence for PAK4s role in cancer. Last December, while Fan was still completing his experiment, Nature Cancer published a paper from Antoni Ribas UCLA lab suggesting that PAK4 inhibitors can help T cells infiltrate around various solid tumors. They showed that the same Karyopharm inhibitor could boost the effects of PD-1 inhibitors in mice, allowing activated T cells to better reach tumors.

That work has already translated into the clinic; weeks after it came out, Karyopharm added an arm to their Phase I study of the drug that will look at the PAK4 inhibitor in combination with the PD-1 blocker Opdivo.

Ribas said that Fans work is compelling and helps confirm the role of PAK4, but he said a CAR-T therapy would face a much longer path to the clinic. Its simply much easier to combine an approved drug with an experimental one than to devise a new CAR-T therapy, mix it with the unapproved inhibitor (and all the other things, such as bone marrow-clearing chemotherapy, CAR-T recipients receive) and then deduce what effect each is having.

It will a take a while, Ribas told Endpoints. But I hope this is right and its developed clinically.

There are also other unresolved obstacles for CAR-T in solid tumors, Wen said. Developers still struggle to find targets that wont also send the super-charged T cells after healthy tissue. And tangled blood vessels are just one of several mechanisms tumors have of defending themselves. They can, for example, turn tumor-eating immune cells into tumor-defending ones.

Still, Wen said, in the short term, the approach offered a path toward boosting the efficacy of radiation, chemotherapy and other small molecule drugs. Although Fan focused on glioblastoma, researchers agreed PAK4 likely plays the same vessel-warping role in many other solid tumors.

Theres a lot of things you could look at, he said.

In a January review, Jessica Fessler and Thomas Gajewski at the University of Chicago said Ribas paper pointed towards a path for improving PD-1 and overcoming resistance in some tumors. But they also raised questions about the Karyopharm drug, noting that it hits other proteins besides PAK4. That could mean other mechanisms are also at play and that the drug could affect other tissues in humans.

Ribas agreed that Karyopharms drug might not be the perfect molecule but said others could be on their way. He serves as a scientific advisor to Arcus, the Terry Rosen startup that is now working on developing its own PAK4 inhibitor.

If they can develop a very selective PAK4 inhibitor, he said, it may be a more direct way of testing the role of PAK4.

Tests with that drug, in turn, could help clear up a biological mystery that emerged out of Fans and Ribas papers. Although both investigators zeroed in on PAK4, each of them suggested very different mechanisms by which PAK4 kept immune cells out of the tumor. Ribas suggested it directly suppresses T cells, while Fan found it led to those transformations inside the blood vessels near the tumor.

Kinases are versatile proteins and both researchers said its possible that PAK4 is doing both. Its also possible, they said, that one is more important than the other, or simply that one of them is just wrong.

When you start with completely new biology, its hard to get it right the first time, Ribas said.

Original post:
Penn researchers find a way through the labyrinth keeping CAR-T from solid tumors - Endpoints News

Read More...

Nobel Prize history from the year you were born – Auburn Citizen

December 3rd, 2020 11:52 pm

Since 1901, Nobel Prizes have honored the worlds best and brightest and showcased the work of brilliant and creative minds, thanks to Swedish businessman Alfred Nobel, who made his fortune with the invention of dynamite.

The Prize in Physiology or Medicine often honors those whose discoveries led to medical breakthroughs, new drug treatments, or a better understanding of the human body that benefit us all.

The Prize in Literature celebrates those skilled in telling stories, creating poetry, and translating the human experience into words. The Prizes in Chemistry and Physics remind most of us how little we understand of genetics, atomic structures, or the universe around us, celebrating the scientists who further knowledge. A later addition to the award roster, the Nobel Memorial Prize in Economic Sciences is not an original Prize, but was established by the Central Bank of Sweden in 1968 as a memorial to Alfred Nobel. It applauds those who can unravel the mysteries of markets, trade, and money.

The Peace Prize celebrates, in Nobels words, the person who shall have done the most or the best work for fraternity between nations, the abolition or reduction of standing armies and for the holding and promotion of peace congresses, sometimes risking their lives to do so.

So precious are the awards that the medals of German physicists Max von Laue and James Franck, stored away for safekeeping in Copenhagen during World War II, were dissolved in acid to keep them away from approaching Nazi troops. After the war, the gold was reconstituted from the acid and recast into new medals.

But Nobel history has not been entirely noble. In 1939, British Prime Minister Neville Chamberlain, known for his policy of appeasement toward Nazi Germany, was nominated for the Peace Prize. In an act of irony and protest, members of the Swedish Parliament nominated Adolf Hitler. That nomination was withdrawn. Some recipients have ordered oppressive crackdowns on their own people or ignored genocides, either before or after receiving the Prize. The 1918 Nobel Prize in Chemistry was given to Germanys Fritz Haber, who invented a method of producing ammonia on a large scale, which was helpful in making fertilizer. But the same chemist helped develop the chlorine gas that was used as a chemical weapon in World War I.

Stacker looked at facts and events related to the Nobel Prizes each year from 1931 to 2020, drawing from the Nobel Committees recollections and announcements, news stories, and historical accounts.

Take a look, and see what was happening with the Nobel Prizes the year you were born.

You may also like: 100 years of military history

View original post here:
Nobel Prize history from the year you were born - Auburn Citizen

Read More...

PBRM1 and the glycosylphosphatidylinositol biosynthetic pathway promote tumor killing mediated by MHC-unrestricted cytotoxic lymphocytes – Science…

December 3rd, 2020 11:52 pm

INTRODUCTION

Cytotoxic lymphocytes (CLs) are subtypes of immune cells capable of detecting and killing tumor and virus-infected cells (1, 2). Current cancer immunotherapy mainly harnesses the antitumor activities of cytotoxic T cells, effectors of the adaptive immune system (25). T cells detect transformed cells by using their T cell receptors to recognize tumor neoantigens displayed on the major histocompatibility complex (MHC) class I proteins of tumor cells (68). T cellbased therapies such as checkpoint inhibitors substantially extend the survival of a subset of patients with cancer (35, 9). Many tumors, however, are unresponsive to checkpoint therapies, possibly because of defects in presentation of tumor antigens on MHC class I (2). Moreover, tumor cells that initially respond to checkpoint inhibitor therapies often develop acquired resistance, resulting in tumor relapses (2, 4). Therefore, additional immunotherapeutic strategies are needed to achieve sustained clinical benefits in a larger patient population.

Another class of tumor-killing CLs are MHC-unrestricted CLs, which include natural killer (NK) cells, effectors of the innate immune system, and NK-like cell lines (1014). Unlike T cells, MHC-unrestricted CLs kill tumor or virally infected cells without requiring prior activation by MHC-presented antigens (6, 15, 16). The absence of MHC class I on target cells serves as a strong activation signal for MHC-unrestricted CLs (1, 6, 10, 12, 17). As a result, MHC-unrestricted CLs are capable of detecting and destroying tumor cells resistant to T cellmediated attack, holding great promise as mono or combination immunotherapies (18, 19). However, the antitumor activities of MHC-unrestricted CLs have not been translated into significant clinical benefits to patients, likely because of escape mechanisms evolved by tumor cells to circumvent killing (19, 20). To improve the efficacy of MHC-unrestricted CLs in immunotherapy, it is critical to identify genes controlling the response of tumor cells to cytotoxicity.

In this work, we performed genome-wide genetic screens to uncover tumor-intrinsic genes that regulate tumor killing by MHC-unrestricted CLs. Our screens identified a large number of regulators that either promote or inhibit the response of tumor cells to killing. The screens isolated known mediators of NK cellmediated killing, but most of the identified genes were not previously linked to tumor killing. Multiple top-ranking genes in the screens belong to the glycosylphosphatidylinositol (GPI) anchor biosynthetic pathway, which is not involved in T cellmediated killing. Further analyses revealed that the GPI biosynthetic pathway is required for the activation and cytolytic granule secretion of CLs. Another critical regulator identified in the screens was PBRM1, a component of the SWI/SNF chromatin-remodeling complex. Notably, PBRM1 promotes the killing of tumor cells by MHC-unrestricted CLs, in contrast to its inhibitory activity in T cellmediated killing. Thus, PBRM1 plays opposite roles in MHC-restricted and MHC-unrestricted cytotoxicity. Like the GPI biosynthetic pathway, PBRM1 promotes cytolytic granule secretion in CLs. The factors identified in this work could represent potential targets for cancer immunotherapy.

We developed a tumor-killing platform using TALL-104 cells, a clinically relevant CL cell line exhibiting robust MHC-unrestricted cytotoxicity against human tumors (14, 18, 2123). Despite the T cell origin of this cell line, TALL-104 cells express NK cell receptors and closely resemble NK cells in recognizing and destroying tumors without prior sensitization (fig. S1) (14). Previously, TALL-104 cells have been used in clinical trials to treat patients with cancer (14, 18, 2124). A major advantage of TALL-104 cells is that they can be readily expanded into large homogeneous populations to meet the demands of genome-wide genetic screens. We observed that TALL-104 cells efficiently killed HAP1 cells (Fig. 1A and fig. S2A), a haploid human cell line derived from chronic myeloid leukemia cells (2527). By contrast, primary human cells, including peripheral blood mononuclear cells (PBMCs) and adipose stem cells (ASCs), were resistant to TALL-104mediated killing (Fig. 1A and fig. S2B), consistent with the ability of CLs to distinguish between tumor and normal cells (68).

(A) TALL-104 cells (CLs) kill HAP1 cells (tumor cells) but not normal cells. HAP1 cells and human PBMCs grown on a 24-well plate were treated with the indicated ratios of TALL-104 cells for 8 hours. The cells were stained with propidium iodide (PI) and measured by flow cytometry. Error bars indicate SD (n = 3). P values were calculated using Students t test. ***P < 0.001. n.s., P > 0.05. (B) Illustration of the genome-wide haploid genetic screen aiming to identify tumor-intrinsic genes required for TALL-104 cytotoxicity. (C) Bubble graph showing significant hits from the haploid genetic screen. The y axis depicts the log10 of P values for the gene hits in the TALL-104selected population as compared to a published unselected control (62) using Fishers exact test. Dashed line indicates the cutoff of significance. We set a P value cutoff of 1 105 to account for multiple hypothesis testing. In addition, for genes with P values less than 1 1010, we considered a gene as a hit only if it also had strong enrichment for sense-strand intron insertions based on the binomial test (P value cutoff: 1 105). The x axis depicts the chromosomal positions of the genes. The size of a circle is scaled according to the number of unique inactivating gene-trap insertions within the gene. Circles are colored according to the annotated or predicted functions of the gene products. Genes that did not reach the cutoff are shown in gray. Full datasets of the screen are included in table S1.

To systematically identify tumor-intrinsic genes required for TALL-104mediated killing, pooled HAP1 cells were randomly mutagenized using retroviral gene-trap insertions (2729). The mutagenized HAP1 cells were incubated with TALL-104 cells for four consecutive rounds, in which approximately 50% of the HAP1 cells were killed during each round (Fig. 1B). After the final round of killing, the TALL-104resistant HAP1 population was harvested, and their gene-trap retroviral insertions were mapped by deep sequencing. The gene-trap insertions were then compared to those of an untreated control HAP1 population to identify significant hits on the basis of the enrichment of inactivating gene-trap insertions.

The haploid genetic screen identified a number of genes that promote TALL-104mediated killing (Fig. 1C and table S1). Mutations of these genes in target cells caused resistance to TALL-104mediated cytotoxicity. One gene identified in the screen was NCR3LG1/B7H6, which encodes an activating ligand for the NK cell receptor NKp30 (Fig. 1C) (30). Another hit from the screen was PVR/CD155, which encodes a ligand for DNAX accessory molecule 1 (DNAM-1), another activating receptor on NK cells (Fig. 1C) (1012). Our screen also recovered IFNGR2, which encodes the interferon- (IFN-) receptor critical to NK cellmediated cytotoxicity (1012). Recovery of these known mediators of NK cell cytotoxicity strongly supports the physiological relevance of the screen and further demonstrates that TALL-104 cells resemble NK cells in tumor killing. Most of the hits, however, were not previously linked to CL-mediated killing.

Multiple genes identified in the screen, including PIGP, PIGS, PIGL, and GPAA1, encode enzymes responsible for the biosynthesis of the GPI moiety of GPI-anchored proteins (GPI-APs) (Fig. 1C) (28). Thus, the GPI anchor biosynthetic pathway is required for tumor cell sensitivity to TALL-104mediated cytotoxicity. Another top-ranking hit was PBRM1/BAF180, which encodes a subunit of the PBAF form of the SWI/SNF chromatin-remodeling complex (Fig. 1C) (31, 32). Other genes isolated in the screen encode factors involved in a range of cellular processes including membrane trafficking and gene expression (fig. S3).

Since a large fraction of the inactivating gene-trap insertions in the primary screen were within the GPI anchor biosynthetic genes (table S1), additional regulators might have been masked. To this end, we next performed a genome-scale modifier screen using GPI-deficient HAP1 cells. We used CRISPR-Cas9 genome editing to delete PIGP, a key gene in GPI anchor biosynthesis (28). Surface expression of the GPI-AP CD59 was abolished (Fig. 2A), confirming the loss of the GPI anchor in PIGP knockout (KO) cells. GPI anchordeficient HAP1 cells were still killed by TALL-104 cells, albeit with a significantly lower efficiency.

(A) Flow cytometry measurements of the surface levels of CD59, a GPI-AP used as a marker for the GPI pathway (CD59 is not involved in CL-mediated killing). PIGP KO HAP1 cells were generated using CRISPR-Cas9 genome editing. A lack of surface CD59 in pooled PIGP KO cells indicates that the GPI pathway was abolished. WT, wild-type. (B) Screen hits from the modifier haploid genetic screen using the PIGP KO HAP1 cells. The screen was performed as described in Fig. 1. The y axis depicts the log10 of P values for the gene hits in the TALL-104 selected population compared to the unselected control using Fishers exact test. We set a P value cutoff of 1 105 to account for multiple hypothesis testing. In addition, we considered a gene as a hit only if it also had strong enrichment for sense-strand intron insertions based on the binomial test (P value cutoff: 1 105). The x axis depicts the chromosomal positions of the genes. The size of the circle is scaled according to the number of unique inactivating gene-trap insertions with the gene. Circles are colored according to the annotated or predicted functions of the gene products. Dashed line indicates the cutoff of significance. Genes that did not reach the cutoff are shown in gray. Full datasets are included in table S2. (C) Lists of genes identified in the primary and modifier screens. Genes linked to cancer or CL killing are highlighted in bold. Cancer association is based on the COSMIC database.

The modifier screen using GPI anchordeficient cells recovered most of the hits from the primary screen including NCR3LG1, PVR, and IFNGR2 (Fig. 2, B and C), validating the critical roles of these genes in TALL-104mediated killing. As expected, none of the genes involved in GPI anchor biosynthesis were recovered in the modifier screen (Fig. 2, B and C; figs. S3 and S4; and table S2). The modifier screen identified many additional genes including TNFRSF10A and TNFRSF10B (Fig. 2, B and C), which encode TRAIL death receptors known to mediate CL-mediated killing (6, 10). These findings are consistent with roles of death receptors in NK cellmediated killing. Other genes identified in the modifier screen were not previously linked to tumor killing. Notably, a subset of the genes identified in the primary screen including PBRM1 were not recovered in the modifier screen (Fig. 2, B and C, and fig. S4), suggesting that these genes might be linked to the GPI biosynthetic pathway in TALL-104mediated killing.

Previous genetic screens dissected MHC-restricted tumor killing mediated by cytotoxic T lymphocytes (3335). Next, we compared the hits from our screens with those from T cellbased screens. The IFN- receptor was also recovered in T cell screens (3335), in agreement with the role of the IFN- pathway in both MHC-restricted and MHC-unrestricted cytotoxicity (8, 10, 12). However, most of the hits from our genetic screens, including the GPI biosynthetic genes, were not isolated in T cellbased screens (3335). Likewise, most genes identified in T cellbased screens were not recovered in our screens. In particular, a large portion of genes identified in T cellbased screens encode regulators of the MHC class I and PD-L1 (programmed cell death 1 ligand 1) pathways (3335). As expected, these genes were not recovered in our MHC-unrestricted screens (Fig. 2C and fig. S4). Notably, although PBRM1 was also isolated in T cellbased screens of tumor killing (35), its function is distinct: PBRM1 inhibits T cellmediated cytotoxicity but promotes TALL-104mediated killing (Fig. 1C) (35). Thus, PBRM1 plays both positive and negative roles in tumor killing. Together, these findings demonstrate differences between the regulatory networks underlying MHC-restricted and MHC-unrestricted cytotoxicity.

According to gene set enrichment analysis (GSEA) (36), the factors identified in our screens belong to multiple KEGG (Kyoto Encyclopedia of Genes and Genomes) pathways and form physical or functional networks (figs. S5 and S6 and table S3). Approximately half of the hits identified in our screens were mutated in human cancers according to the Catalogue of Somatic Mutations in Cancer (COSMIC) database (Fig. 2C). Since these genes do not regulate cell growth (table S4), our data suggest that cancer-linked mutations in these genes may promote tumorigenesis by preventing NK cellmediated tumor killing.

Next, we sought to identify tumor-intrinsic genes encoding negative regulators of TALL-104mediated killing on the basis of depletion of inactivating gene-trap insertions. To accurately calculate gene-trap depletion from a large mutant cell population, we developed gene-trap strand profile (GSP), a scoring metric based on the numbers of unique inactivating (sense) or neutral (antisense) gene-trap insertions within the introns of a candidate gene. A negative GSP score represents the depletion of inactivating gene-trap insertions in a gene, corresponding to a detrimental effect of the gene KO on cell viability (fig. S7, A to C). As a proof of concept, we used the GSP scoring metric to identify the genes essential to the viability or growth of HAP1 cells in the absence of TALL-104 cells. Approximately 1788 essential genes were identified, encompassing all known essential pathways such as translation, transcription, and RNA splicing (fig. S7, D and E, and table S4). This list included virtually all the essential genes identified in previous genetic studies (26, 37), suggesting that GSP scores accurately quantify gene-trap depletions.

Subsequently, we identified genes with significantly negative GSP scores in TALL-104selected HAP1 cells but not in the passage control population. Mutations of these genes sensitize the tumor cells to TALL-104mediated killing, leading to the depletion of inactivating gene-trap insertions. Thus, these genes encode negative regulators of tumor killing by TALL-104 cells. One of the negative factors identified in both the primary and modifier screens was CFLAR (CASP8 and Fas-associated death domain protein (FADD)like apoptosis regulator) (Fig. 3A), a known inhibitor of TRAIL-mediated apoptosis (38, 39). Another negative factor identified in both the primary and modifier screens was MGA, a transcription factor not previously linked to CL-mediated cytotoxicity (Fig. 3A). The ratio of inactivating and neutral gene-trap insertions in CFLAR and MGA genes was approximately 1:1 in the absence of TALL-104 selection, indicating that CFLAR and MGA are not essential to cell growth (Fig. 3A). However, their inactivating gene-trap insertions were strongly depleted after TALL-104 selection (Fig. 3A), reflecting the inhibitory roles of these genes in TALL-104mediated killing. Other negative regulators identified in the screens encompass a range of biological pathways such as TRAIL signaling, transcriptional regulation, and membrane trafficking (Fig. 3, B and C). A group of negative regulators identified in the primary screen were also recovered in the modifier screen (Fig. 3B and fig. S8). Many others, however, were not isolated in the modifier screen (fig. S8 and tables S5 and S6). While a subset of the negative regulators such as CFLAR were also involved in T cellmediated killing (3335), most of the factors were not recovered in T cellbased screens of tumor killing, again highlighting the fundamental differences between MHC-unrestricted and MHC-restricted cytotoxicity.

(A) Visual representations of gene-trap insertions in CFLAR and MGA in the passage control (no TALL-104 selection), the primary screen, and the modifier screen. The gray boxes indicate exons, while the gray lines indicate introns. The gray arrows depict the directions of transcription. Chromosomal locations of inactivating, sense gene-trap insertions are shown in red, while chromosomal locations of neutral, antisense insertions are shown in blue. GSP is a new scoring metric based on the numbers of unique sense (inactivating) or antisense (neutral) gene-trap insertion within the introns of a candidate gene. GSP = [log2(S/A) log10(S A)], where S and A represent the numbers of sense and antisense gene-trap insertions, respectively. (B) Top: Color key of the heatmap. Bottom: Heatmap showing the genes with significantly negative GSP scores in both the primary and modifier screens but not in the passage control. The complete lists of genes are included in fig. S8 and tables S5 and S6. The GSP scores of the genes were quantile-normalized. Genes with significantly negative GSP scores in both screens were clustered using the Euclidean distance metric. Dashed gray lines represent the sample mean, while the solid gray lines represent each hits GSP score relative to the sample mean. The color of each bar represents the GSP score. Genes associated with cancer or CL killing are highlighted in bold. Cancer association is based on the COSMIC database. (C) Summary of the negative regulators identified in the primary and modifier screens based on annotated or predicted gene function. Full datasets are shown in tables S5 and S6.

Next, we sought to determine the molecular mechanism of the GPI anchor biosynthetic pathway in tumor killing. Deletion of the PIGP gene in HAP1 cells abrogated surface expression of GPI-APs (Figs. 2A and 4A and fig. S9A). We mixed the PIGP KO cells with wild-type (WT) HAP1 cells and examined their sensitivity to TALL-104mediated cytotoxicity in a competition assay, which accurately measures the proliferation and death of cell populations (40). We observed that the ratio of WT and PIGP KO cells did not change significantly during passage in the absence of TALL-104 cells (Fig. 4, A and B), confirming that PIGP mutations do not affect cell growth. By contrast, PIGP KO cells were strongly enriched after two rounds of TALL-104 treatment (Fig. 4, A and B). These data demonstrate that mutation of the GPI biosynthetic pathway in HAP1 cells causes resistance to TALL-104mediated killing, validating the result of our genetic screens. Likewise, mutation of PIGP in 786-O cells, a human renal cancer cell line (41), caused resistance of the cells to TALL-104mediated killing (Fig. 4C). Thus, the role of the GPI biosynthetic pathway in tumor killing is not limited to HAP1 cells.

(A) A mixed population of WT and PIGP KO HAP1 cells was either untreated or treated with TALL-104 cells. Negative surface staining of CD55, a GPI-AP not involved in CL-mediated killing, was used as a marker for PIGP KO cells. CD55+ WT cells and CD55 PIGP KO cells were analyzed by flow cytometry. (B) Percentage of WT and PIGP KO HAP1 cells in the passage control or TALL-104treated population. (C) Percentage of WT and PIGP KO 786-O cells in the passage control or TALL-104treated population. CD55+ WT cells and CD55 PIGP KO 786-O cells were quantified by flow cytometry after each round of treatment. Data in (B) and (C) are presented as mean values (n = 3). (D) Normalized surface levels of immune regulators on WT and PIGP KO HAP1 cells. (E) TALL-104 degranulation presented as normalized surface levels of LAMP1 on TALL-104 cells. (F) Normalized surface levels of TRAIL on TALL-104 cells. (G) Normalized surface levels of CD69 on TALL-104 cells. Data in (D) to (G) are presented as means SD (n = 3). P values were calculated using Students t test. n.s., P > 0.05. ***P < 0.001.

TALL-104mediated killing closely resembles NK cellmediated cytotoxicity (Figs. 1 and 2) (42). Next, we directly examined how PIGP KO cells respond to NK cellmediated cytotoxicity. Using a propidium iodide (PI) uptake assay, we observed that PIGP KO cells were substantially more resistant to killing by primary human NK cells (fig. S9B). Thus, mutation of the GPI biosynthetic pathway in target cells also impairs NK cellmediated cytotoxicity.

We then tested how the GPI biosynthetic pathway regulates tumor surface molecules required for MHC-unrestricted cytotoxicity. Both TRAIL receptor and PVR (Poliovirus receptor) regulate TALL-104mediated killing (Fig. 2) (15, 16). However, surface levels of these molecules were not reduced in PIGP KO cells (Fig. 4D), indicating that their functions are independent of the GPI biosynthetic pathway. We then examined UL16-binding proteins (ULBPs), ligands for the activating NK cell receptor NKG2D (19). Since multiple ULBP genes were simultaneously expressed in HAP1 cells (Fig. 4D), ULBPs were not recovered in our screens because of functional redundancy. ULBPs are GPI-APs containing a C-terminal GPI anchor, although a subset of ULBPs also have a transmembrane domain (43, 44). It has been suggested that the GPI anchor and transmembrane domain play redundant roles in ULBP surface localization and activation of NKG2D (43). However, we observed that surface expression of ULBPs was completely lost in PIGP KO cells (Fig. 4D). Thus, despite the presence of transmembrane domains, the GPI anchor is essential to surface expression of ULBPs.

Next, we examined how the GPI biosynthetic pathway in tumor cells influences the function of CLs after cell-cell interaction. A major route of CL-mediated killing involves the secretion of the cytolytic molecules granzyme and perforin (7, 10, 11), which occurs when cytolytic granules fuse with the plasma membrane of a CL (8, 45). To measure cytolytic granule secretion, we used a flow cytometrybased degranulation assay to quantify surface levels of lysosomal-associated membrane protein 1 (LAMP1; also known as CD107a), a cytolytic granule protein that is exposed to the cell surface after cytolytic granules fuse with the plasma membrane (Fig. 4E) (45, 46). LAMP1 is a specific marker for degranulation as the lysosome-like cytolytic granule is not involved in the trafficking of other cytotoxic molecules such as IFN- and death receptor ligands (4750). Using this degranulation assay, we observed that TALL-104 cells exhibited little surface LAMP1 expression in the absence of HAP1 cells (Fig. 4E), consistent with a lack of cytolytic granule secretion in unstimulated CLs. Incubation with HAP1 cells, however, strongly increased the surface levels of LAMP1 on TALL-104 cells (Fig. 4E). Notably, PIGP KO HAP1 cells induced minimal LAMP1 externalization on TALL-104 cells (Fig. 4E), demonstrating that these mutant cells were defective in triggering the secretion of cytolytic molecules.

Besides cytolytic molecules, death ligands such as TRAIL are also used by CLs to kill tumor cells (10, 51). Our screens recovered TRAIL receptors (TNFRSF10A and TNFRSF10B) as hits (Fig. 2, B and C). In the absence of target cells, TALL-104 cells exhibited low surface levels of TRAIL (Fig. 4F). Incubation with WT HAP1 cells strongly elevated surface TRAIL on TALL-104 cells, while PIGP KO HAP1 cells were largely defective in inducing TRAIL surface expression (Fig. 4F). We also examined IFN-, a cytokine released by CLs to promote tumor killing. We observed that similar amounts of IFN- were released from NK cells when they were incubated with WT or PIGP KO HAP1 cells (fig. S10). Thus, IFN- release is not dependent on the GPI biosynthetic pathway of tumor cells.

We then determined whether the GPI biosynthetic pathway regulates CL activation. We examined the surface expression of CD69, an activation marker of NK cells (52, 53). We observed that TALL-104 cells displayed low surface CD69 expression in the absence of HAP1 cells (Fig. 4G). Addition of WT HAP1 cells strongly elevated surface levels of CD69 on TALL-104 cells (Fig. 4G). By contrast, PIGP KO HAP1 cells were largely defective in inducing CD69 expression (Fig. 4G). Thus, PIGP is essential to the activation of TALL-104 cells by tumor cells, consistent with its roles in cytolytic granule secretion and TRAIL expression. Together, these data indicate that the GPI biosynthetic pathway of tumor cells is required for the activation and cytotoxic functions of MHC-unrestricted CLs, providing a molecular explanation for its activating role in MHC-unrestricted cytotoxicity.

We next characterized PBRM1, a subunit of the PBAF chromatin-remodeling complex mutated in a large number of human cancers (Figs. 2 and 5A) (31, 32, 54). To validate the functional role of PBRM1 in TALL-104mediated cytotoxicity, we deleted the PBRM1 gene in HAP1 cells using CRISPR-Cas9 (Fig. 5B). WT and PBRM1 KO HAP1 cells were mixed and subjected to multiple rounds of TALL-104 treatment in a competition assay. We observed that PBRM1 KO cells were significantly enriched after three rounds of TALL-104 treatment (Fig. 5, C and D). By contrast, the ratio of WT and PBRM1 KO cells did not change significantly during passage in the absence of TALL-104 selection (Fig. 5, C and D), confirming that PBRM1 KO did not affect cell growth (32, 55). These results demonstrate that deletion of the PBRM1 gene in target cells caused resistance to TALL-104mediated killing, validating the finding of our genetic screen. Next, we examined the sensitivity of the cells to primary human NK cells. While WT HAP1 cells were efficiently killed by NK cells, PBRM1 KO cells were substantially more resistant to killing (Fig. 5E), confirming the critical role of PBRM1 in NK cellmediated cytotoxicity.

(A) Visual representations of gene-trap insertions in the PBRM1 gene in the screens. The gray boxes indicate exons, and the gray lines indicate introns. The gray arrows depict the direction of transcription. (B) Immunoblot showing PBRM1 expression in WT HAP1 cells and a clonal PBRM1 KO HAP1 cell line. PBRM1 mRNA expression in these cells is shown in fig. S13. (C) WT (GFP+) and PBRM1 KO (GFP) cells in mixed populations were quantified by flow cytometry after three rounds of passage or TALL-104 treatment. (D) Percentage of WT and PBRM1 KO HAP1 cells in the passage control or TALL-104treated population. Data are presented as mean values (n = 3). (E) Percentage of propidium iodidepositive WT and PBRM1 KO HAP1 cells after treatment with primary human NK cells. (F) Mean surface levels of immune regulators on WT and PBRM1 KO HAP1 cells. (G) TALL-104 degranulation presented as normalized surface levels of LAMP1 on TALL-104 cells after incubation with target cells. (H) NK-92 degranulation presented as normalized surface levels of LAMP1 in NK-92 cells. Data in (E) to (H) are presented as means SD (n = 3). P values were calculated using Students t test. n.s., P > 0.05. *P < 0.05, **P < 0.01, ***P < 0.001.

Next, we further examined how PBRM1 regulates the response of tumor cells to killing. Since loss of MHC class I promotes killing by MHC-unrestricted CLs (19), the resistance of PBRM1 KO cells to killing could be due to up-regulation of MHC class I. However, we observed that surface levels of MHC class I molecules were moderately reduced in PBRM1 KO cells (fig. S11), indicating that the resistance of the KO cells to killing was not caused by up-regulation of MHC class I. Surface levels of TRAIL receptor and PVR were not significantly reduced in the KO cells (Fig. 5F). Mutation of PBRM1 markedly decreased surface expression of ULBPs in HAP1 cells (Fig. 5F). Thus, like PIGP, PBRM1 broadly regulates surface expression of ULBPs in target cells. The overall similarity of PIGP and PBRM1 KO phenotypes prompted us to examine whether PBRM1 regulates cytolytic granule secretion. Using the flow cytometrybased degranulation assay, we observed that HAP1-triggered externalization of LAMP1 in TALL-104 cells was markedly reduced when PBRM1 was mutated (Fig. 5G). Likewise, KO of PBRM1 diminished the ability of HAP1 cells to induce LAMP1 externalization in NK cells (Fig. 5H). Thus, PBRM1 is required for triggering cytolytic granule secretion from MHC-unrestricted CLs. We also tested other molecules of CLs involved in target cell killing. We observed that target cellinduced surface expression of TRAIL in TALL-104 cells was reduced when PBRM1 was mutated in HAP1 cells (fig. S12). By contrast, target cellinduced IFN- release was not affected by PBRM1 KO in HAP1 cells (fig. S10). Together, these results demonstrate that PBRM1 regulates ULBP expression in tumor cells and promotes cytolytic granule secretion from MHC-unrestricted CLs.

This work revealed a complex network of tumor-intrinsic factors that positively or negatively regulate the response of tumor cells to NK cells and other clinically significant MHC-unrestricted CLs. Mutations of these factors either cause resistance or enhance sensitivity to killing. The screens identified known genes involved in NK cellmediated killing such as ligands of NK cell receptors. Most of the genes isolated in the screens, however, were not previously linked to tumor killing. Notably, most of our hits including PBRM1 and GPI biosynthetic genes were not recovered in previous attempts to genetically dissect NK cellmediated killing (5658), likely because of the unique genetic screening platform used in this work. The advantages of this platform include homogeneous populations of CLs with consistent tumor-killing activities and a multiround selection procedure that can identify genes with a wide range of KO phenotypes.

A large portion of the genes identified in the screens were mutated in human cancers. Most of these genes do not regulate cell proliferation or response to T cellmediated cytotoxicity, suggesting that their mutations promote cancer progression by impairing NK cellmediated killing of tumor cells. These findings will be valuable for personalized evaluation of cancer genomes and immunotherapeutic strategies. An unexpected discovery of this study is that the genes regulating tumor response to killing are fundamentally distinct between MHC-unrestricted and MHC-restricted CLs. While a subset of our hits including the IFN- receptor and CFLAR are also involved in T cellmediated killing (3335), the vast majority of the genes identified in our screens are unique to tumor response to MHC-unrestricted cytotoxicity. Likewise, most of the genes identified in previous T cellbased screens were not involved in tumor response to killing by MHC-unrestricted CLs. Knowledge of tumor responses to MHC-unrestricted CLs is integral to understanding how tumor cells interact with the immune system and how they evade cancer immunosurveillance to develop into metastatic malignancies.

A major group of genes identified in our screens encode enzymes involved in the biosynthesis of the GPI anchor. We found that mutation of GPI biosynthetic pathway abolishes the surface expression of all ULBPs. This finding indicates that, although certain ULBPs also have transmembrane domains besides the GPI anchor, the GPI anchor is essential for their surface localization. Thus, manipulation of the GPI biosynthetic pathway has the potential to simultaneously target the entire ULBP family of proteins. It is possible that ULBP deficiency fully accounts for the defects of activation and cytotoxic functions of CLs caused by mutations of GPI biosynthesis. However, since cells express nearly 200 GPI-APs (59), it remains possible that additional GPI-APs other than ULBPs are also involved in tumor cells response to killing.

An unexpected finding of this study is that PBRM1 plays opposite roles in MHC-restricted and MHC-unrestricted tumor killing. A tumor suppressor mutated in a number of tumors including clear-cell renal cell carcinoma (31, 32, 35, 54), PBRM1 negatively regulates T cellmediated tumor killing by modulating the expression of cytotoxic signaling molecules (32, 35). While this inhibitory activity correlates well with the clinical benefits of PBRM1 mutations in checkpoint therapies (32, 35), it cannot fully explain the tumor suppressor role of PBRM1. Our findings suggest that PBRM1 mutations promote tumorigenesis by impairing NK cellmediated clearance of tumor cells. PBRM1 regulates surface expression of ULBPs, which are NKG2D ligands. The overall KO phenotype of PBRM1 is remarkably similar to that of PIGP, suggesting that PBRM1 may control the expression, maturation, or localization of a GPI biosynthetic gene(s) rather than individual ULBPs. Further research using human samples and mouse models will be needed to test this possibility.

Both the innate and adaptive immune systems are involved in cancer immunosurveillance, and cancer arises when both systems fail (7, 12). Given the complementary nature of MHC-restricted and MHC-unrestricted CLs in tumor killing, it is conceivable that combinatorial therapies using both types of CLs would achieve the best therapeutic outcomes. NK cells are capable of detecting and eliminating tumor cells refractory to T cellmediated cytotoxicity and are particularly powerful in eradicating metastatic tumor cells and cancer stem cells (1113). To be effective, cancer immunotherapies must overcome resistance to CL-mediated cytotoxicity. The large number of tumor-intrinsic factors identified in this work provides a rich source of potential targets to enhance and maintain the response of tumor cells to endogenous NK cells or engineered NK cells and NK-like cell lines in adoptive transfer therapies.

HAP1 cells were cultured in Iscoves Modified Dulbeccos Medium (IMDM) supplemented with 10% fetal bovine serum (FBS), l-glutamine, and penicillin/streptomycin. 293T cells were cultured in Dulbeccos modified Eagles medium (DMEM) supplemented with 20% FBS, l-glutamine, and penicillin/streptomycin. 786-O cells [American Type Culture Collection (ATCC), no. CRL-1932] were cultured in RPMI 1640 supplemented with 10% FBS, l-glutamine, and penicillin/streptomycin. NK-92 cells (ATCC, no. CRL-2407) were cultured in minimum essential medium Eagle, alpha modification supplemented with 12.5% FBS, 12.5% Donor Equine Serum, 2 mM l-glutamine, 0.2 mM myo-inositol (Acros Organics, no. 122261000), 0.1 mM 2-mercaptoethanol, 0.02 mM folic acid (Acros Organics, no. 216630100), and recombinant human interleukin-1 (IL-2) (100 U/ml) (PeproTech, no. 200-02). TALL-104 cells (ATCC, no. CRL-11386) were cultured in IMDM supplemented with 20% FBS, human albumin (2.5 g/ml) (Sigma-Aldrich, no. A9731), d-mannitol (0.5 g/ml) (Acros Organics, no. 125345000), and recombinant human IL-2 (100 U/ml). Primary NK cells (ZenBio, no. SER-PBCD56 + NK-F) were cultured in RPMI 1640 supplemented with 10% FBS, l-glutamine, penicillin/streptomycin, sodium pyruvate, MEM nonessential amino acids, recombinant human IL-2 (100 U/ml), and recombinant human IL-15 (10 U/ml) (PeproTech, no. 200-15). PBMCs (ZenBio, no. SER-PBMC-200) were cultured in RPMI 1640 supplemented with 10% FBS, l-glutamine, penicillin/streptomycin, sodium pyruvate, and MEM nonessential amino acids. Human ASCs (ZenBio, no. ASC-F) were grown in DMEM/Hams F-12 (1:1) media supplemented with 10% FBS and penicillin/streptomycin.

Mutant HAP1 libraries were produced using a previously described procedure (28). Briefly, gene-trap retroviruses were generated by transfecting six T175 flasks of 293T cells with a cocktail of plasmids including pGT-GFP0, pGT-GFP1, pGT-GFP2, pAdVAntage (Promega, no. E1711), pGAL, and pCMV-VSVG using TurboFectin 8.0 (OriGene, no. TF81001). The retroviruses were collected 40 hours after transfection, and again 50 hours after transfection. The retroviruses were concentrated in a Beckman SW 28 rotor at 25,000 rpm for 1.5 hours. Viral pellets were resuspended in 500 l of phosphate-buffered saline (PBS) overnight at 4C. HAP1 cells (1.5 108) were spin-infected twice at 12-hour intervals with 1.5 viral concentrate (by flask surface area) in the presence of protamine sulfate (8 g/ml). After mixture with virus, cells were plated in 12-well plates at 1.5 106 cells per well and centrifuged at 900g for 1.5 hours at room temperature in a Thermo Fisher Scientific Legend RT+ centrifuge. The multiplicity of infection was kept below 1.0 on the basis of green fluorescent protein (GFP) fluorescence. The GPI-deficient library used in the modifier screen was generated using the above protocol. To produce a mutant library in GPI-APdeficient HAP1 cells, unaltered HAP1 cells were spin-infected with lentiCRISPR virus targeting PIGP (see the Genome editing using CRISPR-Cas9 section). Infected cells were stained for surface CD59 by incubation with anti-CD59 (eBioscience, no. 17-0596) antibodies followed by incubation with allophycocyanin (APC)conjugated anti-mouse secondary antibodies (eBioscience, no. 17-4015) (see the Flow cytometry measurements section). HAP1 cells with low cell size (forward scatter) and lack of surface CD59 protein (APC) were collected by fluorescence-activated cell sorting (MoFlo, Beckman Coulter) to isolate a haploid GPI-AP deficient population. This population was used to produce an additional gene-trap library as described above.

A HAP1 cell library consisting of ~1.5 108 mutagenized cells was thawed and allowed to recover for 3 days. The cells were plated at a density of 5 106 cells per 100-mm plate. One population of 1.5 108 cells was plated for selection, and another population of 1.5 108 cells was plated for passage throughout the duration of the screen. HAP1 cells were incubated with approximately equal numbers of TALL-104 cells in the presence of IL-2 (100 U/ml) and the following inhibitor cocktail: soluble TRAIL-R2-Fc chimera at a final concentration of 20 ng/ml (R&D Systems, no. 631-T2-100), soluble TNFR1p55 at a final concentration of 100 ng/ml (a gift of C. Edwards, University of Colorado School of Medicine), soluble tumor necrosis factor receptor 1 (TNFR1)Fc at a final concentration of 5 ng/ml (R&D Systems, no. 372-RI-050), soluble Fas-Fc chimera at a final concentration of 100 ng/ml (R&D Systems, no. 326-FS-050), and LEAF purified anti-human Fas-L at a final concentration of 50 ng/ml (BioLegend, no. 306409). This inhibitor cocktail was intended to partially inhibit the fast-acting death-receptor killing pathways such that the slower granzyme/perforin cytotoxic pathway could also be reflected in the screen.

The killing and detachment of HAP1 cells were periodically examined until ~50% of the HAP1 cells detached from the plate, which usually took 8 to 12 hours. After treatment, the HAP1 cells were washed once with PBS to remove free TALL-104 cells, and fresh media were added. After 24 hours, the HAP1 cells were dissociated using Accutase (Innovative Cell Technologies, #AT 104), counted, and replated at ~5 106 cells per 100-mm plate for the next round of TALL-104 treatment on the following day. The untreated control cells were split, counted, and replated at a similar total cell number and density as the TALL-104treated HAP1 population. After four rounds of TALL-104 treatment, HAP1 cells were expanded and 5 107 cells were used for genomic DNA extraction and linear polymerase chain reaction (PCR) reactions. The modifier screen using PIGP KO HAP1 cells was completed using a similar protocol as the primary screen, except that HAP1 cells were plated at a density of ~4 106 cells per 100-mm plate and the ratio of TALL-104 to HAP1 cells was approximately 2:1 during treatment.

Genomic DNA was extracted from HAP1 cells using a genomic DNA purification kit (Thermo Fisher Scientific, no. K0721). Linear PCR was performed using 2 g of genomic DNA as template and the following primer: [5-Biotin-GGTCTCCAAATCTCGGTGGAAC-3]. After 125 cycles of amplification, the linear PCR products were purified using biotin-binding Dynabeads (Thermo Fisher Scientific, no. 11047). On-bead ligation of a 5phosphorylated, 3-ddC linker was performed using CircLigase II (Epicentre, no. CL9021K). The product was purified and used as a template for PCR to add Illumina adapter sequences I (5-AATGATACGGCGACCACCGAGATCTGATGGTTCTCTAGCTTGCC-3) and II (5-CAAGCAGAAGACGGCATACGA-3). PCR products from 8 to 30 individual PCR reactions were extracted from a 1% tris-acetate-EDTAagarose gel, pooled over a Qiagen Spin column (Qiagen, no. 28706), and sequenced in a lane of the Illumina HiSeq 2000 using a custom primer recognizing the 5end of the LTR (5-CTAGCTTGCCAAACCTACAGGTGGGGTCTTTCA-3).

FASTQ files from Illumina sequencing were preprocessed to filter duplicate reads using custom scripts. FASTQ files containing unique sequences were aligned to the human genome (hg19) using the Bowtie software v0.12.08 (60). The 50base pair (bp) FASTQ sequences were trimmed from their 3 ends to a length of 35 bp, and were aligned in best mode allowing one mismatch. Reads with more than one genomic alignment were suppressed. Aligned sequences were intersected with gene tables obtained from the University of California, Santa Cruz Genome Browser (hg19) containing either exons or introns using BEDTools software v2.17.0 (61). Unique insertions per gene were counted for exons and for introns. The total numbers of unique sense and antisense insertions within introns were counted for each gene. Fishers exact test was calculated using previously published passage control data (28, 62). We developed custom scripts in Python using NumPy, Pandas, SciPy, and matplotlib modules for downstream data analysis, statistics, and visualization. Heatmaps were generated by normalizing unique insertion counts per gene using the quantile method in R. Normalized values were used as input for heatmap.2 (package gplots) run in R. Insertion plots were produced using the package Gviz in R (www.r-project.org/). GSEA was performed using GSEA from the Broad Institute (36).

Guide sequences were designed according to previously published protocols (63). Double-stranded oligonucleotides containing the guide sequences were individually subcloned into pLentiCRISPR V2-puro vectors as previously described (28, 64). The PIGP gene was mutated using one guide, while the PBRM1 gene was mutated by simultaneous introduction of two independent guide sequences. The following guide sequences were used in this study. The protospacer adjacent motifs are underlined: PIGP: 5-TACAGTACTTTACCTCGTGTGGG-3; PBRM1 exon 1: 5-GAAACCACTTCATAATAGTCTGG-3; PBRM1 exon 4: 5-TTGCAAGCGGCTTTATATTCAGG-3.

Adherent cells were detached from culture plates using Accutase to preserve surface antigens for flow cytometry measurements (6466). Cells were labeled using the indicated mouse monoclonal primary antibodies and APC-conjugated anti-mouse secondary antibodies (eBioscience, no. 17-4015) or Alexa Fluor 488conjugated anti-mouse immunoglobulin G2a secondary antibodies (Invitrogen, #A-21131). Exceptions were phycoerythrin (PE)conjugated anti-CD55 antibodies (eBioscience, no. 12-0559-42), APC-conjugated anti-CD45 antibodies (eBioscience, no. 17-0459-42), APC-conjugated antiHLA-A/B/C antibodies (BioLegend, no. 311409), APC-conjugated anti2-microglobulin antibodies (BioLegend, no. 395711), and eFluor 450conjugated anti-CD69 antibodies (eBioscience, no. 48-0699-41). The following unconjugated primary antibodies were used in this study: anti-CD3 antibodies (eBioscience, no. 14-0038-82), anti-CD56 antibodies (eBioscience, no. 14-0567-82), anti-CD314/NKG2D antibodies (BioLegend, no. 320802), anti-CD337/NKp30 antibodies (BioLegend, no. 325202), anti-PrP antibodies (eBioscience, no. 14-9230), anti-CD59 antibodies (eBioscience, no. 17-0596), anti-CD261/TRAIL-R1 antibodies (eBioscience, no. 14-6644-80), anti-CD262/TRAIL-R2 antibodies (eBioscience, no. 14-9909-82), anti-CD155/PVR antibodies (BioLegend, no. 337602), anti-ULBP1 antibodies (R&D Systems, no. MAB1380), anti-ULBP2/5/6 antibodies (R&D Systems, no. MAB1298), anti-ULBP3 antibodies (R&D Systems, no. MAB1517), anti-LAMP1/CD107a antibodies (eBioscience, no. 14-1079-80), and anti-CD253/TRAIL antibodies (eBioscience, no. 16-9927-82). Flow cytometry data were collected on the CyAn ADP Analyzer (Beckman Coulter). Data from populations of approximately 10,000 cells were analyzed using FlowJo 10.1. All flow cytometry experiments were run in biological triplicate to calculate statistical significance.

Cells were lysed in an SDS sample buffer, and the samples were resolved on 8% bis-tris SDSpolyacrylamide gel electrophoresis. PIGP and PBRM1 were detected using rabbit polyclonal anti-PIGP antibodies (Sino Biological, #204171-T36) and rabbit polyclonal anti-PBRM1/BAF180 antibodies (Bethyl Laboratories, no. A301-591A-T), respectively, and horseradish peroxidaseconjugated anti-rabbit secondary antibodies (Sigma-Aldrich, no. A6154). -Tubulin was probed using mouse monoclonal anti-tubulin antibodies (eBioscience, no. 14-4502-82) and horseradish peroxidaseconjugated anti-mouse secondary antibodies (Sigma-Aldrich, no. A6782).

WT and mutant target cells were mixed at a 1:1 ratio and plated in six-well plates in six replicates at a density of 3.5 105 cells per well. After 24 hours, TALL-104 cells were added to three replicates of target cells at a 1:1 ratio. An additional three replicates were passage controls. After 8 hours, the TALL-104 cells were removed by aspiration and washing with PBS. Target cells attached to the plates were allowed to recover overnight. Subsequently, target cells were collected using Accutase digestion. Approximately half of the collected target cells were plated for an additional round of TALL-104 treatment, while the remaining cells were prepared for flow cytometry measurements. Flow cytometry was used to measure the ratio of WT to mutant target cells in each population.

Target cells were plated at ~105 cells per well in a 24-well plate. After 24 hours, primary human NK cells were stained with APC-conjugated anti-CD45 antibodies and added to target cells at a 1:1 ratio in the presence of IL-2, IL-15, and the inhibitor cocktail. After incubation, both nonadherent and adherent cells were collected using Accutase digestion. The cells were stained with propidium iodide and assayed by flow cytometry.

Target cells were plated at ~105 cells per well in a 24-well plate. After 24 hours, CLs (TALL-104 or NK cells) were added to the target cells at a 1:1 ratio in the presence of IL-2 and the inhibitor cocktail. After incubation for 4 hours, both nonadherent and adherent cells were collected using Accutase digestion. The cells were stained with anti-LAMP1 antibodies (eBioscience, no. 14-1079-80) and PE-conjugated anti-mouse secondary antibodies (BioLegend, no. 406608), as well as APC-conjugated anti-CD45 antibodies (eBioscience, no. 17-0459-42). Only CD45+ CLs were included in the analysis (target cells were CD45). CL degranulation was quantified as the fold change of mean LAMP1 protein surface staining normalized to a CL-only control.

Target cells were plated at ~105 cells per well in a 24-well plate. After 24 hours, CLs (TALL-104 or NK cells) were added to the target cells at a 1:1 ratio in the presence of IL-2. After incubation for 24 hours, both nonadherent and adherent cells were collected using Accutase digestion. The cells were stained with anti-CD253/TRAIL antibodies (eBioscience, no. 16-9927-82), PE-conjugated anti-mouse secondary antibodies, and APC-conjugated anti-CD45 antibodies. TRAIL surface levels on CD45+ CLs were quantified using flow cytometry.

Target cells were plated at ~105 cells per well in a 24-well plate. After 24 hours, CLs were added to the target cells at a 1:1 ratio in the presence of IL-2 and the inhibitor cocktail. After incubation for 48 hours, both nonadherent and adherent cells were collected using Accutase digestion. The cells were stained with eFluor 450conjugated anti-CD69 antibodies (eBioscience, no. 48-0699-41) and APC-conjugated anti-CD45 antibodies. Surface levels of CD69 in CD45+ CLs were quantified using flow cytometry.

Total RNAs were isolated using the RNeasy Mini Kit (Qiagen, no. 74104), followed by treatment with ezDNAse (Thermo Fisher Scientific, no. 18091150). First strand complementary DNA synthesis was performed using a SuperScript IV kit (Thermo Fisher Scientific, no. 18091050). Gene expression was determined by quantitative reverse transcription PCR on a Bio-Rad CFX384 Real-time PCR Detection System using SsoAdvanced Universal SYBR Green Supermix (Bio-Rad, no. 172-5272) with gene-specific primer sets. The cycle threshold values of a candidate gene were normalized to those of GAPDH, a reference gene, and the cycle threshold values were calculated. The results were plotted as fold changes relative to the WT sample.

PCR primers for PBRM1 were as follows: CGGGTGTGATGAACCAAGGA (forward) and

TTGGCTGCTGTATGACAGGG (reverse). PCR primers for GAPDH were as follows: GACAGTCAGCCGCATCTTCT (forward) and GCGCCCAATACGACCAAATC (reverse).

Acknowledgments: We thank C. Dinarello, W. Gao, X. Liu, C. Detweiler, L. Lenz, and B. Weaver for advice or reagents. We thank L. Crisman and I. Datta for comments on the manuscript. Funding: This work was financially supported by grants from NIH (GM126960, AG061829, and DK124431 to J.S.; AI128443 to S.L.; AI135473 to H.Y.; GM088759 to B.L.M. and E.M.D.), a Postdoctoral Fellowship from the Postdoctoral Overseas Training Program at Beijing University of Chinese Medicine (S.W.), and seed grants from the Cancer Center and Linda Crnic Institute at University of Colorado (J.S.). Publication of this article was partially funded by the University of Colorado Boulder Libraries Open Access Fund. Author contributions: B.L.M., E.M.D., and J.S. designed the study. B.L.M., E.M.D., S.W., Y.O., and S.L. performed the experiments. B.L.M., E.M.D., S.W., S.L., H.Y., and J.S. analyzed the results and wrote the manuscript. All the authors contributed to the overall scientific interpretation and edited the manuscript. Competing interests: The authors declare that they have no competing interests. Data and materials availability: All data needed to evaluate the conclusions in the paper are present in the paper and/or the Supplementary Materials. Additional data related to this paper may be requested from the authors. All work was carried out at University of Colorado.

Read this article:
PBRM1 and the glycosylphosphatidylinositol biosynthetic pathway promote tumor killing mediated by MHC-unrestricted cytotoxic lymphocytes - Science...

Read More...

Alberta and NWT Bishops OK vaccination for COVID Grandin Media – Grandin Media

December 3rd, 2020 11:50 pm

When a vaccine is available to treat or prevent COVID-19, it is OK to take it.

Thats the message from the bishops of Alberta and the Northwest Territories in a pastoral letter to the faithful as they navigate for Catholics a path through a moral dilemma presented by COVID-19 vaccine development.

While many of the possible vaccines are synthetic and have no relationship to abortion in their production, several contenders were developed using cell lines descended from cells originally derived from aborted fetuses or embryonic stem cells.

The bishops reiterate Church support and encouragement of scientific research into COVID-19, and have decided openly to address the question of possible moral complicity of Catholics in the previous act of abortion.

Even if a vaccine is sourced from cell lines distantly derived from aborted human fetuses, which is an evil act according to Catholic teaching, the bishops say taking that vaccine is morally permissible given the remoteness of the recipient from the original act of abortion, the scarcity of ethical alternatives, and the grave threat that COVID-19 poses to public health.

While physicians and families should seek out ethical vaccines, the bishops say that use of previous cell lines is so prevalent in research that there may not be an ethical alternative accessible during the current COVID-19 pandemic.

Making use of abortion to create cell lines for research and development is an affront to human dignity and cannot be morally justified, the bishops write. Sadly, such cell lines are so widely used in the biopharmaceutical industry that a vaccine that has not been ethically compromised in its production and/or testing by their use may very well not be available for employment against COVID-19.

With respect to someone simply receiving the vaccine, the degree of connection with the original evil act is so remote that, when there also exists a proportionately grave reason for vaccination, such as the current, urgent need to halt the COVID-19 pandemic, then the Church assures us that it is morally permissible for Catholics to receive it for the good of personal and public health.

The official teaching is saying then, if ethical (synthetic) vaccines are truly not available, then take this vaccine, said Dr. Moira McQueen, executive director of the Canadian Catholic Bioethics Institute, who was part of a group advising the bishops on the vaccine letter. The level of moral cooperation by people in 2020 is what the Church would call remote.

Here we are talking about a pandemic. The idea is because of two factors lack of personal responsibility for an original action yet facing serious illness and needing to protect yourselves and your children Church teaching says and I think its reasonable, that in these circumstances taking any vaccine is justified. They wont say the action is right in the fullest sense, but they do say its justified. If an ethical vaccine comes along, you have to choose to use that one.

The bishops letter is in keeping with statements from the Pontifical Academy for Life, which studies issues of biomedicine and law. The Academy has addressed this issue in statements in 2005 and 2017.

Currently, no COVID-19 vaccines are approved by Health Canada. Once approved, Alberta anticipates receiving enough doses of Pfizer and Moderna vaccines to initially immunize up to 435,000 Albertans who are most at-risk, between January and March 2021.

Alberta will roll out COVID-19 vaccines in three phases next year with the initial focus on the provinces most at-risk populations residents and staff of long-term care homes and assisted-living facilities, on-reserve First Nations people, and other health workers.

Premier Jason Kenney said the federal government has assured Alberta that shipments will begin to arrive by Jan. 4 and continue to arrive in waves early next year. Alberta will not make vaccination mandatory, but Kenney said its recommended.

McQueen was part a group of Catholic medical, legal and theological experts who wrote to Prime Minister Justin Trudeau early in the pandemic, pressing for any vaccine to be ethically sourced.

Those two frontrunners, Moderna and Pfizer, are both Messenger RNA vaccines in which molecules are chemically synthesized. However, the Oxford and AstraZeneca vaccines are sourced from cell lines that were originally abortion-derived, according to the Lozier Institute, a pro-life institute based in the U.S., which studied a range of vaccines under development.

Dr. David Evans, professor of medical microbiology at the University of Alberta, is quick to note that the vaccines are sourced differently and the bishops letter shouldnt be used as justification to refuse to be immunized.

Evans, a member of the advisory group to the bishops, leads a team that has studied the coronavirus extensively both with a commercial company, and his lab has also received some funding from the Department of Defence to develop its own vaccine although the local development will only come to light if the current frontrunners fail.

Still McQueen expects some Catholics and others to refuse a vaccine as a matter of conscience.

It may seem acceptable to some people not to take the vaccine and say they will stay at home and never leave. But I dont see how people could reasonably take a stance like that and then go out into society, as they must at some point and perhaps they are carriers, she said. Theres very much the reality of an individual conscience decision, which should always be respected. But that person always has to be thinking too about her or his responsibility to everybody else.

Catholic teaching on the common good is also a factor in making a good conscience decision, McQueen said.

Evans noted that any government-approved vaccine will be safe and effective, however its not yet known how long the immunity will last. Patients may have to be inoculated again with a booster after weeks or months.

Visit link:
Alberta and NWT Bishops OK vaccination for COVID Grandin Media - Grandin Media

Read More...

The way prisoners flag guard abuse, inadequate health care and unsanitary conditions Is broken – injusticewatch.org

December 3rd, 2020 11:50 pm

Randy Liebich curled up in a ball on his bed inside Stateville prison, about an hour outside Chicago. It was June 2010, and hed spent the night in a cold sweat, excruciating pain radiating from his back. For months, hed been filing complaints with prison officials about the lack of medical care. But the forms, known as grievances, got him nowhere.

One was denied, in part because hed already been to the doctor, and the denial noted hed received acetaminophen pain medication. Another complaint was deemed moot.

Investigations that expose, influence and inform. Emailed directly to you.

Now Liebich was in the worst pain of his life. According to medical records, a kidney stone had made it impossible for him to urinate. The men in nearby cells shouted for help.

Correctional officers took Liebich to the medical office, where, records show, a doctor used a hemostat, a tweezer-like surgical tool, to try to remove the stone through the tip of Liebichs penis. But the procedure failed, leaving the stone intact. About six hours passed that day before Liebich was driven to an outside hospital for emergency surgery.

When Liebich got back to the prison, he filed two more grievances about the poor medical treatment hed received. If staff had addressed his earlier complaints, he wrote, he could have avoided the procedure with the hemostat altogether. But prison officials denied those grievances too.

Liebich filed over a dozen more grievances related to his kidney condition over the next eight years, until a judge threw out his murder conviction in 2018 after finding his lawyers ignored key evidence. Prosecutors later dropped all charges, but Liebich says he still suffers trauma from his experience with the hemostat.

People locked inside prisons rely on grievances to complain if their needs, from health care to sanitation to safety, are unmet. The complaints are among their few means of recourse. But in Illinois, that system is sputtering, with little oversight, leaving prisoners vulnerable to harm, an investigation by WBEZ and ProPublica has found.

The state has paid millions to settle the claims of inmates, some of whom raised concerns early through grievances, only to later suffer serious injuries when authorities denied complaints or failed to act.

In one case, a prisoner at Stateville Correctional Center filed a grievance to complain about roaches crawling over him as he slept. He also said he had extreme pain in his ear and heard constant crackling. But he said his complaints were ignored by prison staff. Two weeks after his grievance, records show medical workers removed a bug from his ear. He later filed a lawsuit, alleging ear pain and hearing loss. The case was settled for $12,500, three and a half years after the first grievance. The state denied wrongdoing.

In another case, a man at Stateville spent months filing grievances and writing letters to prison officials about a protruding bolt near his bunk bed. The warden denied the grievances, because theyd been filed as emergencies, and he disagreed with the classification. Eight months after the prisoners initial complaint, he fell out of his bed and hit his eye on the bolt, resulting in disability and disfigurement, according to a lawsuit he filed. Records show he was treated by a doctor the same day. The state disputed the mans claims in court documents, but the parties agreed to a settlement in which the state paid the inmate $70,000.

In Liebichs case, he filed a lawsuit over the medical treatment he received and alleged that prison staff retaliated against him for complaining. The state denied wrongdoing but agreed to a settlement of $70,000.

The Illinois prison system, which had an average daily population of about 40,000 people last year, is now under federal oversight as part of a legal agreement to improve health care in state prisons. A court-appointed expert found in 2018 that the medical care was so poor that people were needlessly dying.

Because grievances can serve as early warnings for prison administrators about dangerous conditions, experts say tracking the complaints is critical.

But WBEZ and ProPublica found Illinois is faltering. The news organizations requested five years of data from the 15 largest prisons, showing the number of grievances and how they were resolved. Only seven were able to provide information that was complete enough to analyze. Some institutions had an entire year of data missing.

Hokyoung Kim for ProPublica

Of the grievances that were reviewed by prison officials, about 5% were decided in part, or in whole, in a prisoners favor. Inmates can appeal to a Department of Corrections review board, but the approval rate there was similar, the WBEZ-ProPublica analysis found.

States have different methods of tracking grievances, and its difficult to compare Illinois system to other jurisdictions, but experts said the findings suggest its not working as it should.

With a rate that low, it just seems like nobody believes in the system, said Dan Pacholke, former administrator for the Washington State Department of Corrections and co-author of a book on prison safety. It would certainly be concerning for me as a superintendent of a prison.

Others were more blunt.

What we have here is sort of the fox watching the henhouse, said Jenny Vollen-Katz, executive director of the John Howard Association, an independent citizen group that has monitored Illinois prisons for more than a century.

WBEZ and ProPublica sought an interview with state corrections officials over the course of four months, but the department declined multiple requests. In a written response, it said the approval rate appeared artificially low, in part, because of prolific grievance filers and frivolous complaints. It also noted that many grievances are resolved informally by counselors; about 13% of grievances in the analysis were withdrawn by the inmate before an official review.

Still, in response to a detailed outline of our findings, corrections officials said they were pursuing a number of measures to improve the grievance system, including plans to hire a chief inspector to oversee the statewide system. Officials also said the department would be transitioning to electronic grievances, a move that would make the system more efficient and data easier to track.

The operation of a fair and consistent grievance process is a high priority for the Department, and we are working diligently to improve the current system, the department said in the statement. Through the implementation of significant reforms and an increase in oversight, we can ensure the concerns of men and women in custody are addressed in a timely manner.

Prison watchdog groups and some lawmakers lauded the changes, but they said Illinois system needs a bigger overhaul with more oversight. Some are pushing a proposal to create an ombudsman that would investigate complaints about the department.

Illinois State Rep. La Shawn Ford, a Democrat and former head of the House Restorative Justice Committee, said family members of people in prison regularly call his office asking for help with a grievance. He commended the departments proposed changes but said officials need to make sure that theres a process in place that will allow for the best outcomes for the people making grievances.

You cannot be the judge and the jury and the prosecutor.

In the fall of 1971, nearly 1,300 prisoners took over Attica Correctional Facility in New York to protest abuse and poor living conditions. It was one of the most violent prison standoffs in U.S. history, leaving 43 people dead. Over the next few years, other prison uprisings broke out across the country, as the prison rights movement grew. A report from the U.S. Department of Justice said the lack of grievance systems had probably made these incidents inevitable, because prisoners had no other way to get their needs heard.

Toussaint Losier, a professor of Afro-American studies at the University of Massachusetts-Amherst who has studied American prisons, said grievance systems emerged in this era to create a safety valve to let off some of the steam that could build up over time. But states also had another incentive. Lawsuits filed by prisoners were clogging the federal court system; by 1974, 1 in 20 civil cases filed in federal court were prison civil rights cases, according to Margo Schlanger, a professor of civil rights law at the University of Michigan and a leading expert on prison litigation. Federal judges called for another venue to evaluate complaints. As one put it, if prisoners had a fair alternative, theyd choose that over the delayed process of the courts.

But even after states created grievance systems, the deluge of lawsuits continued. A study from the early 1980s found people incarcerated at two Illinois prisons thought the states grievance system was wholly institution controlled and rarely yielding favorable or even impartial results.

To stem the tide of lawsuits, Congress passed the Prison Litigation Reform Act, or PLRA, in 1996. The legislation made grievances critical by requiring inmates to exhaust the prisons internal grievance system before filing a lawsuit. A co-sponsor of the bill, Sen. Strom Thurmond, R-S.C., said it would prevent frivolous and malicious lawsuits filed by prison inmates. Opponents, including then-Sen. Joe Biden, D-Del., argued the bill unwisely limited the courts power to protect the constitutional rights of people behind bars. The results of the law were striking. The number of lawsuits filed per prisoner shrank by more than 50% over the next two decades, according to Schlanger.

But thats not because prisoners problems were suddenly being addressed through grievances. In fact, some experts say the PLRA may have actually made grievance systems worse. After the law passed, some corrections officials raised administrative hurdles for the complaints, and in doing so made it harder to file lawsuits. Schlanger said prison officials in some states threw out grievances for tiny technical violations, like writing in the wrong color ink.

In Illinois, the state Department of Corrections reduced the window of time within which prisoners can file most grievances from six months to 60 days. It also limited outside oversight of appeals, eliminating a rule that required at least one review board member to come from outside the department. The agency did not respond to a question about the changes.

But officials did note that one reason the approval rate of grievances is so low is because prisoners make technical mistakes, like missing a deadline.

There was a huge incentive to make the grievance process as complicated and as impossible to complete properly as they could, said Alan Mills, a lawyer and executive director of the Uptown Peoples Law Center who has spent decades representing prisoners in Illinois.

Instead of protecting prisoners rights, Mills said grievance systems instead work to protect the department and its employees from lawsuits. In 2011, Mills was part of a team that filed a class-action lawsuit on behalf of deaf and hard of hearing prisoners who werent getting hearing aids or access to interpreters. The plaintiffs argued that they were unable to participate in education programs, stay in contact with loved ones or discuss medical issues with doctors. Mills estimates it took lawyers 18 months to figure out how to exhaust the grievance process so they could move forward with the lawsuit. For example, Mills said, sometimes prison officials would only respond to one issue in a grievance even if a prisoner had listed several issues. This made it unclear if the other issues had been denied, ignored or granted leaving the prisoner unsure if they needed to file additional grievances.

This is 10 extremely qualified, experienced lawyers trying to figure out how to navigate this process. Imagine what somebody who dropped out of sixth grade and is sitting in a jail cell with no resources at all; how they can ever figure out how to make it through that process? Mills said.

The lawsuit later settled with the state agreeing to provide accommodations for deaf and hard of hearing prisoners.

In the spring of 2011, officers at Lincoln Correctional Center ordered about 200 women out of their housing unit. Wielding batons and shields, officers marched the prisoners into a gymnasium and conducted a series of strip-searches, according to a lawsuit the women filed in federal court.

The women were then forced to spread their buttocks and vaginas in view of male staff, and officers made derogatory comments about their bodies, according to the lawsuit. The women, who alleged the search constituted cruel and unusual punishment, also said they were forced to remove tampons and bled on themselves while they waited for others to be searched.

A lawyer for the Department of Corrections denied those claims of mistreatment and said the search was necessary to keep the facility safe from contraband. A jury decided against the prisoners, but the women appealed on different constitutional grounds and that case is ongoing.

Dozens of the women said they filed grievances over the strip-search. But as time passed, many didnt get an answer. Later, the nonprofit John Howard Association conducted a monitoring visit to the prison. According to its report, the group said it heard a significant number of consistent, unsolicited, and independent reports about the strip-search and missing grievances. But the group said that when it asked prison administrators about it, they could not locate a single grievance related to the incident. Nevertheless, the nonprofits report said officials there acknowledged problems with the grievance system and said they made changes to improve tracking.

Maggie Burke, a former state corrections official who retired as warden of Logan Correctional Center in 2017, said grievances routinely disappeared. If it was just an occasional my grievance disappeared, I would think that it was someone who was exaggerating, she said, adding, But it happened a lot.

The problem was so bad that when she became the statewide coordinator for women and family services within the department about two years after the strip-search incident she added locked boxes that only she and her assistant could access. That gave prisoners a direct and more secure way to express concerns or send her grievances.

The system is critical, Burke said, because people may act out violently or create other problems when their grievances arent addressed.

Dwaine Coleman said thats what he did while incarcerated at Vienna Correctional Center in 2014 for marijuana possession. He complained of excruciating back pain, and prison records show he had previously been diagnosed with sciatica. But he said a doctor did little more than tell him to eat well and exercise. So he filed a grievance asking to see another doctor.

A month passed before a corrections counselor wrote that the care Coleman was receiving was appropriate, and the grievance went up the chain of command. Two weeks later, he had yet to get a decision from the warden. Desperate to grab the attention of senior prison officials, Coleman tied his prison-issued bed sheet in knots and began flushing it, bit by bit, down the toilet. The water gushed over the bowl, flooding his cell, according to court records.

The grievance system is a joke. So you kind of have to act out to get your needs met, Coleman said in an interview. When you start to act out, there are incident reports that have to be sent all around, and now theres a paper trail and a lot more people are getting involved.

Coleman said his attempts backfired though and tensions between him and the staff continued to escalate. A few days after the toilet incident, Coleman said he got into an argument with a correctional officer during a medical evaluation, according to a lawsuit he filed. On the way back from the health care unit, Coleman alleged, the officer rammed his head into a doorway. A dental record from about two weeks later shows a chipped tooth. During a civil trial, the officer denied assaulting him. But a jury decided in Colemans favor and awarded him $35,000 in punitive damages.

Coleman did eventually get a decision from the warden on his health care grievance three months after he filed it. The complaint was denied, saying the care he received was appropriate.

Few prisoners in Illinois have faith in the grievance system. Just 5% considered it effective, according to a 2019 survey by the John Howard Association, which collected responses from 12,780 prisoners across the state. And only 13% said they felt comfortable filing a grievance.

The biggest reason that people dont feel comfortable is fear of retaliation, said Vollen-Katz, executive director of the watchdog group.

After Liebich filed grievances complaining about the poor medical care hed received for his kidney stone, he said staff began to view him as a nuisance. In January 2011 officers came to his cell and, according to court records, insisted that he give a urine sample for a drug test.

Hokyoung Kim for ProPublica

Liebich told the correctional officers that his kidney condition made that difficult. Officers told him that if he didnt urinate in the next two hours hed be sent to the hole, officially known as segregation. Its a part of the facility where prisoners are sent as punishment, infamous for being filthy, full of bugs and vermin. (In fact, the conditions were so bad that officials shut down that section of the prison in 2016, though it was reopened for COVID-19 quarantining this year.) For Liebich, the pressure to provide a urine sample felt immense. So, with minutes left to his deadline, he asked if he could have more time.

The guards refused and took him to segregation, according to prison records. Because staff knew his trouble with urination, he believes the whole incident was meant to punish him for filing grievances.

Liebichs lawyer sent emails to the warden, letting him know about Liebichs medical condition. But according to records provided by the lawyer, the warden responded that Liebich would need to address his problem through the grievance process.

Five days after the drug test incident, Liebich filed a complaint over being sent to segregation. The officer that reviewed his grievance recommended the warden approve it, according to prison records, but the warden disagreed and Liebich remained in segregation. Still, in August 2011, Liebich pressed forward with a lawsuit alleging poor medical treatment and retaliation. In court documents, prison officials agreed that Liebich was sent to segregation for failure to provide a urine sample, but they denied that officers were acting in retaliation.

The state agreed to a settlement of $70,000 in January 2015, four years after Liebich filed his grievance over his punishment.

Civil rights lawyers, former prison administrators and prisoners say the only way more people behind bars will get their concerns addressed is with independent oversight and increased transparency.

Currently, the entire grievance process is overseen by the Corrections Department.

Grievances first go to a counselor who attempts to resolve the complaint. If they cannot, a grievance officer evaluates the case and makes a recommendation to the warden, who renders a decision. If a prisoner is dissatisfied with the response, they can send their complaint to a statewide board that reviews grievance appeals called the Administrative Review Board.

The whole process can be time consuming.

The state Corrections Department would not say if it had any data showing the speed at which prisons resolved grievances. Records, however, suggest that many complaints were reviewed slowly, or not at all. Over a third of appeals were thrown out because the prisoner had already been released or died by the time the review board evaluated them.

Of those that were reviewed, 7% were found partially or wholly in favor of the prisoner. The panel evaluates thousands of grievances a month. Complaints can range from a missing radio to guard abuse.

When youre seeing that many grievances, its easy to go, Yeah. OK. You know, that one I dont really have time for, said Joni Stahlman, former assistant deputy director of the womens division who sat on the Administrative Review Board in the early 2000s. Theres that tricky line of fairness and getting the work done.

Prison advocates point to a more fundamental issue though: While the four members of the board do not work at any individual prison, they are still employed by the Corrections Department and appointed by the director. Sitting on the current board are two members who previously worked clerical jobs within the department and one who formerly worked inside a prison as a correctional counselor. Vollen-Katz, of the John Howard Association, said thats not true independence. We are asking a closed system to police itself, she said.

Vollen-Katz said one step the state could take would be to create a corrections ombudsman who could investigate complaints and find solutions. Mills, the civil rights lawyer, agreed, saying the Illinois Department of Juvenile Justice already has such a person who gets copies of all the grievances so that they can track them, find trends, figure out problems, and then bring them to the attention of the department to fix.

An ombudsman in the adult system, he said, would be a huge, huge step forward.

In order for it to be effective, though, the position would need complete autonomy, enforcement capabilities and the power to share information with lawmakers and the public, advocates said. Other states, like New Jersey and Washington, already have a corrections ombudsman, and last year Illinois state lawmakers submitted a bill to create one. But the legislation stalled.

Illinois State Rep. Rita Mayfield, who co-sponsored the ombudsman bill, said she planned to revive the legislation next year. She said one of her central motivations was discovering and fixing problems before they become expensive lawsuits.

What can we do to reduce these losses? What is wrong with the system? What can we correct to better utilize those tax dollars? Mayfield said. The Department of Corrections would not answer questions about its stance on an ombudsman.

Losier, the professor who has studied prisons, said another key change to the grievance system should be more transparency. New York state, for example, issues yearly reports on what types of grievances are filed and how the department handles them. That allows the public and lawmakers to monitor whats happening inside. But Illinois issues no such report.

New Yorks Corrections Department also maintains a database that tracks staff involved in misconduct and abuse claims, so the department can look for patterns. But in Illinois, despite records showing staff misconduct is one of the largest issues for prisoners, the department doesnt track grievances by guard name.

Burke, the former warden, said that having that information, even internally, would be helpful. If we have, you know, 90% of our grievances are on one person, then we know that theres a problem there.

Pacholke, the former administrator for the Washington State Department of Corrections, agreed, saying data collection is critical. If youre not tracking it, the next thing you know, something really horrific or tragic can happen, he said.

Neither the Corrections Department nor AFSCME, the union that represents most front-line corrections staff, responded to questions about the potential of tracking complaints about correctional officers.

In Liebichs case, problems within the prison persisted.

In January 2018, after his lawsuit was settled, the staff decided to test him for drugs again, according to discipline records. When he couldnt provide a urine sample, officers sent him back to segregation.

They just went through this with me. They know I have these medical issues, Liebich said in an interview. They know I had a civil suit about it, and they turn around and they did the same thing to me again.

Liebich spent his days in a cramped cell. The prison allowed inmates to leave their cells for mental health groups. Liebich said sessions were held in the former execution area, from when Illinois had the death penalty.

You can literally feel the hairs on your arms and your neck stand up, Liebich said. He felt powerless.

In January 2019, Liebich filed a second lawsuit against the prison over retaliation. Later that year the state agreed to settle and paid him $25,000, but denied wrongdoing.

Today, he said he still has nightmares about his time inside segregation.

Its frightening to think that they can do this to us and get away with it, Liebich said, and theres nobody that we can really go to for help.

The rest is here:
The way prisoners flag guard abuse, inadequate health care and unsanitary conditions Is broken - injusticewatch.org

Read More...

From Roaches To Medical Emergencies, Illinois Inmates Say Theres Nobody That We Can Really Go To For Help – WBEZ

December 3rd, 2020 11:50 pm

This article was produced in partnership with the ProPublica Local Reporting Network. Sign up for ProPublicas Big Story newsletter to get stories like this one as soon as they are published.

Randy Liebich curled up in a ball on his bed inside Stateville prison, about an hour outside Chicago. It was June 2010, and hed spent the night in a cold sweat, excruciating pain radiating from his back. For months, hed been filing complaints with prison officials about the lack of medical care. But the forms, known as grievances, got him nowhere.

One was denied, in part because hed already been to the doctor, and the denial noted hed received acetaminophen pain medication. Another complaint was deemed moot.

Now Liebich was in the worst pain of his life. According to medical records, a kidney stone had made it impossible for him to urinate. The men in nearby cells shouted for help.

Correctional officers took Liebich to the medical office, where, records show, a doctor used a hemostat, a tweezer-like surgical tool, to try to remove the stone through the tip of Liebichs penis. But the procedure failed, leaving the stone intact. About six hours passed that day before Liebich was driven to an outside hospital for emergency surgery.

When Liebich got back to the prison, he filed two more grievances about the poor medical treatment hed received. If staff had addressed his earlier complaints, he wrote, he could have avoided the procedure with the hemostat altogether. But prison officials denied those grievances too.

Liebich filed over a dozen more grievances related to his kidney condition over the next eight years, until a judge threw out his murder conviction in 2018 after finding his lawyers ignored key evidence. Prosecutors later dropped all charges, but Liebich says he still suffers trauma from his experience with the hemostat.

People locked inside prisons rely on grievances to complain if their needs, from health care to sanitation to safety, are unmet. The complaints are among their few means of recourse. But in Illinois, that system is sputtering, with little oversight, leaving prisoners vulnerable to harm, an investigation by WBEZ and ProPublica has found.

The state has paid millions to settle the claims of inmates, some of whom raised concerns early through grievances, only to later suffer serious injuries when authorities denied complaints or failed to act.

In one case, a prisoner at Stateville Correctional Center filed a grievance to complain about roaches crawling over him as he slept. He also said he had extreme pain in his ear and heard constant crackling. But he said his complaints were ignored by prison staff. Two weeks after his grievance, records show medical workers removed a bug from his ear. He later filed a lawsuit, alleging ear pain and hearing loss. The case was settled for $12,500, three and a half years after the first grievance. The state denied wrongdoing.

In another case, a man at Stateville spent months filing grievances and writing letters to prison officials about a protruding bolt near his bunk bed. The warden denied the grievances, because theyd been filed as emergencies, and he disagreed with the classification. Eight months after the prisoners initial complaint, he fell out of his bed and hit his eye on the bolt, resulting in disability and disfigurement, according to a lawsuit he filed. Records show he was treated by a doctor the same day. The state disputed the mans claims in court documents, but the parties agreed to a settlement in which the state paid the inmate $70,000.

In Liebichs case, he filed a lawsuit over the medical treatment he received and alleged that prison staff retaliated against him for complaining. The state denied wrongdoing but agreed to a settlement of $70,000.

The Illinois prison system, which had an average daily population of about 40,000 people last year, is now under federal oversight as part of a legal agreement to improve health care in state prisons. A court-appointed expert found in 2018 that the medical care was so poor that people were needlessly dying.

Because grievances can serve as early warnings for prison administrators about dangerous conditions, experts say tracking the complaints is critical.

But WBEZ and ProPublica found Illinois is faltering. The news organizations requested five years of data from the 15 largest prisons, showing the number of grievances and how they were resolved. Only seven were able to provide information that was complete enough to analyze. Some institutions had an entire year of data missing.

Of the grievances that were reviewed by prison officials, about 5% were decided in part, or in whole, in a prisoners favor. Inmates can appeal to a Department of Corrections review board, but the approval rate there was similar, the WBEZ-ProPublica analysis found.

States have different methods of tracking grievances, and its difficult to compare Illinois system to other jurisdictions, but experts said the findings suggest its not working as it should.

With a rate that low, it just seems like nobody believes in the system, said Dan Pacholke, former administrator for the Washington State Department of Corrections and co-author of a book on prison safety. It would certainly be concerning for me as a superintendent of a prison.

Others were more blunt.

What we have here is sort of the fox watching the henhouse, said Jenny Vollen-Katz, executive director of the John Howard Association, an independent citizen group that has monitored Illinois prisons for more than a century.

WBEZ and ProPublica sought an interview with state corrections officials over the course of four months, but the department declined multiple requests. In a written response, it said the approval rate appeared artificially low, in part, because of prolific grievance filers and frivolous complaints. It also noted that many grievances are resolved informally by counselors; about 13% of grievances in the analysis were withdrawn by the inmate before an official review.

Still, in response to a detailed outline of our findings, corrections officials said they were pursuing a number of measures to improve the grievance system, including plans to hire a chief inspector to oversee the statewide system. Officials also said the department would be transitioning to electronic grievances, a move that would make the system more efficient and data easier to track.

The operation of a fair and consistent grievance process is a high priority for the Department, and we are working diligently to improve the current system, the department said in the statement. Through the implementation of significant reforms and an increase in oversight, we can ensure the concerns of men and women in custody are addressed in a timely manner.

Prison watchdog groups and some lawmakers lauded the changes, but they said Illinois system needs a bigger overhaul with more oversight. Some are pushing a proposal to create an ombudsman that would investigate complaints about the department.

Illinois State Rep. La Shawn Ford, a Democrat and former head of the House Restorative Justice Committee, said family members of people in prison regularly call his office asking for help with a grievance. He commended the departments proposed changes but said officials need to make sure that theres a process in place that will allow for the best outcomes for the people making grievances.

You cannot be the judge and the jury and the prosecutor.

In the fall of 1971, nearly 1,300 prisoners took over Attica Correctional Facility in New York to protest abuse and poor living conditions. It was one of the most violent prison standoffs in U.S. history, leaving 43 people dead. Over the next few years, other prison uprisings broke out across the country, as the prison rights movement grew. A report from the U.S. Department of Justice said the lack of grievance systems had probably made these incidents inevitable, because prisoners had no other way to get their needs heard.

Toussaint Losier, a professor of Afro-American studies at the University of Massachusetts-Amherst who has studied American prisons, said grievance systems emerged in this era to create a safety valve to let off some of the steam that could build up over time. But states also had another incentive. Lawsuits filed by prisoners were clogging the federal court system; by 1974, 1 in 20 civil cases filed in federal court were prison civil rights cases, according to Margo Schlanger, a professor of civil rights law at the University of Michigan and a leading expert on prison litigation. Federal judges called for another venue to evaluate complaints. As one put it, if prisoners had a fair alternative, theyd choose that over the delayed process of the courts.

But even after states created grievance systems, the deluge of lawsuits continued. A study from the early 1980s found people incarcerated at two Illinois prisons thought the states grievance system was wholly institution controlled and rarely yielding favorable or even impartial results.

To stem the tide of lawsuits, Congress passed the Prison Litigation Reform Act, or PLRA, in 1996. The legislation made grievances critical by requiring inmates to exhaust the prisons internal grievance system before filing a lawsuit. A co-sponsor of the bill, Sen. Strom Thurmond, R-S.C., said it would prevent frivolous and malicious lawsuits filed by prison inmates. Opponents, including then-Sen. Joe Biden, D-Del., argued the bill unwisely limited the courts power to protect the constitutional rights of people behind bars. The results of the law were striking. The number of lawsuits filed per prisoner shrank by more than 50% over the next two decades, according to Schlanger.

But thats not because prisoners problems were suddenly being addressed through grievances. In fact, some experts say the PLRA may have actually made grievance systems worse. After the law passed, some corrections officials raised administrative hurdles for the complaints, and in doing so made it harder to file lawsuits. Schlanger said prison officials in some states threw out grievances for tiny technical violations, like writing in the wrong color ink.

In Illinois, the state Department of Corrections reduced the window of time within which prisoners can file most grievances from six months to 60 days. It also limited outside oversight of appeals, eliminating a rule that required at least one review board member to come from outside the department. The agency did not respond to a question about the changes.

But officials did note that one reason the approval rate of grievances is so low is because prisoners make technical mistakes, like missing a deadline.

There was a huge incentive to make the grievance process as complicated and as impossible to complete properly as they could, said Alan Mills, a lawyer and executive director of the Uptown Peoples Law Center who has spent decades representing prisoners in Illinois.

Instead of protecting prisoners rights, Mills said grievance systems instead work to protect the department and its employees from lawsuits. In 2011, Mills was part of a team that filed a class-action lawsuit on behalf of deaf and hard of hearing prisoners who werent getting hearing aids or access to interpreters. The plaintiffs argued that they were unable to participate in education programs, stay in contact with loved ones or discuss medical issues with doctors. Mills estimates it took lawyers 18 months to figure out how to exhaust the grievance process so they could move forward with the lawsuit. For example, Mills said, sometimes prison officials would only respond to one issue in a grievance even if a prisoner had listed several issues. This made it unclear if the other issues had been denied, ignored or granted leaving the prisoner unsure if they needed to file additional grievances.

This is 10 extremely qualified, experienced lawyers trying to figure out how to navigate this process. Imagine what somebody who dropped out of sixth grade and is sitting in a jail cell with no resources at all; how they can ever figure out how to make it through that process? Mills said.

The lawsuit later settled with the state agreeing to provide accommodations for deaf and hard of hearing prisoners.

In the spring of 2011, officers at Lincoln Correctional Center ordered about 200 women out of their housing unit. Wielding batons and shields, officers marched the prisoners into a gymnasium and conducted a series of strip-searches, according to a lawsuit the women filed in federal court.

The women were then forced to spread their buttocks and vaginas in view of male staff, and officers made derogatory comments about their bodies, according to the lawsuit. The women, who alleged the search constituted cruel and unusual punishment, also said they were forced to remove tampons and bled on themselves while they waited for others to be searched.

A lawyer for the Department of Corrections denied those claims of mistreatment and said the search was necessary to keep the facility safe from contraband. A jury decided against the prisoners, but the women appealed on different constitutional grounds and that case is ongoing.

Dozens of the women said they filed grievances over the strip-search. But as time passed, many didnt get an answer. Later, the nonprofit John Howard Association conducted a monitoring visit to the prison. According to its report, the group said it heard a significant number of consistent, unsolicited, and independent reports about the strip-search and missing grievances. But the group said that when it asked prison administrators about it, they could not locate a single grievance related to the incident. Nevertheless, the nonprofits report said officials there acknowledged problems with the grievance system and said they made changes to improve tracking.

Maggie Burke, a former state corrections official who retired as warden of Logan Correctional Center in 2017, said grievances routinely disappeared. If it was just an occasional my grievance disappeared, I would think that it was someone who was exaggerating, she said, adding, But it happened a lot.

The problem was so bad that when she became the statewide coordinator for women and family services within the department about two years after the strip-search incident she added locked boxes that only she and her assistant could access. That gave prisoners a direct and more secure way to express concerns or send her grievances.

The system is critical, Burke said, because people may act out violently or create other problems when their grievances arent addressed.

Dwaine Coleman said thats what he did while incarcerated at Vienna Correctional Center in 2014 for marijuana possession. He complained of excruciating back pain, and prison records show he had previously been diagnosed with sciatica. But he said a doctor did little more than tell him to eat well and exercise. So he filed a grievance asking to see another doctor.

A month passed before a corrections counselor wrote that the care Coleman was receiving was appropriate, and the grievance went up the chain of command. Two weeks later, he had yet to get a decision from the warden. Desperate to grab the attention of senior prison officials, Coleman tied his prison-issued bed sheet in knots and began flushing it, bit by bit, down the toilet. The water gushed over the bowl, flooding his cell, according to court records.

The grievance system is a joke. So you kind of have to act out to get your needs met, Coleman said in an interview. When you start to act out, there are incident reports that have to be sent all around, and now theres a paper trail and a lot more people are getting involved.

Coleman said his attempts backfired though and tensions between him and the staff continued to escalate. A few days after the toilet incident, Coleman said he got into an argument with a correctional officer during a medical evaluation, according to a lawsuit he filed. On the way back from the health care unit, Coleman alleged, the officer rammed his head into a doorway. A dental record from about two weeks later shows a chipped tooth. During a civil trial, the officer denied assaulting him. But a jury decided in Colemans favor and awarded him $35,000 in punitive damages.

Coleman did eventually get a decision from the warden on his health care grievance three months after he filed it. The complaint was denied, saying the care he received was appropriate.

Few prisoners in Illinois have faith in the grievance system. Just 5% considered it effective, according to a 2019 survey by the John Howard Association, which collected responses from 12,780 prisoners across the state. And only 13% said they felt comfortable filing a grievance.

The biggest reason that people dont feel comfortable is fear of retaliation, said Vollen-Katz, executive director of the watchdog group.

After Liebich filed grievances complaining about the poor medical care hed received for his kidney stone, he said staff began to view him as a nuisance. In January 2011, officers came to his cell and, according to court records, insisted that he give a urine sample for a drug test.

Liebich told the correctional officers that his kidney condition made that difficult. Officers told him that if he didnt urinate in the next two hours hed be sent to the hole, officially known as segregation. Its a part of the facility where prisoners are sent as punishment, infamous for being filthy, full of bugs and vermin. (In fact, the conditions were so bad that officials shut down that section of the prison in 2016, though it was reopened for COVID-19 quarantining this year.) For Liebich, the pressure to provide a urine sample felt immense. So, with minutes left to his deadline, he asked if he could have more time.

The guards refused and took him to segregation, according to prison records. Because staff knew his trouble with urination, he believes the whole incident was meant to punish him for filing grievances.

Liebichs lawyer sent emails to the warden, letting him know about Liebichs medical condition. But according to records provided by the lawyer, the warden responded that Liebich would need to address his problem through the grievance process.

Five days after the drug test incident, Liebich filed a complaint over being sent to segregation. The officer that reviewed his grievance recommended the warden approve it, according to prison records, but the warden disagreed and Liebich remained in segregation. Still, in August 2011, Liebich pressed forward with a lawsuit alleging poor medical treatment and retaliation. In court documents, prison officials agreed that Liebich was sent to segregation for failure to provide a urine sample, but they denied that officers were acting in retaliation.

The state agreed to a settlement of $70,000 in January 2015, four years after Liebich filed his grievance over his punishment.

Civil rights lawyers, former prison administrators and prisoners say the only way more people behind bars will get their concerns addressed is with independent oversight and increased transparency.

Currently, the entire grievance process is overseen by the Corrections Department.

Grievances first go to a counselor who attempts to resolve the complaint. If they cannot, a grievance officer evaluates the case and makes a recommendation to the warden, who renders a decision. If a prisoner is dissatisfied with the response, they can send their complaint to a statewide board that reviews grievance appeals called the Administrative Review Board.

The whole process can be time consuming.

The state Corrections Department would not say if it had any data showing the speed at which prisons resolved grievances. Records, however, suggest that many complaints were reviewed slowly, or not at all. Over a third of appeals were thrown out because the prisoner had already been released or died by the time the review board evaluated them.

Of those that were reviewed, 7% were found partially or wholly in favor of the prisoner. The panel evaluates thousands of grievances a month. Complaints can range from a missing radio to guard abuse.

When youre seeing that many grievances, its easy to go, Yeah. OK. You know, that one I dont really have time for, said Joni Stahlman, former assistant deputy director of the womens division who sat on the Administrative Review Board in the early 2000s. Theres that tricky line of fairness and getting the work done.

Prison advocates point to a more fundamental issue though: While the four members of the board do not work at any individual prison, they are still employed by the Corrections Department and appointed by the director. Sitting on the current board are two members who previously worked clerical jobs within the department and one who formerly worked inside a prison as a correctional counselor. Vollen-Katz, of the John Howard Association, said thats not true independence. We are asking a closed system to police itself, she said.

Vollen-Katz said one step the state could take would be to create a corrections ombudsman who could investigate complaints and find solutions. Mills, the civil rights lawyer, agreed, saying the Illinois Department of Juvenile Justice already has such a person who gets copies of all the grievances so that they can track them, find trends, figure out problems, and then bring them to the attention of the department to fix.

An ombudsman in the adult system, he said, would be a huge, huge step forward.

In order for it to be effective, though, the position would need complete autonomy, enforcement capabilities and the power to share information with lawmakers and the public, advocates said. Other states, like New Jersey and Washington, already have a corrections ombudsman, and last year Illinois state lawmakers submitted a bill to create one. But the legislation stalled.

Illinois State Rep. Rita Mayfield, who co-sponsored the ombudsman bill, said she planned to revive the legislation next year. She said one of her central motivations was discovering and fixing problems before they become expensive lawsuits.

What can we do to reduce these losses? What is wrong with the system? What can we correct to better utilize those tax dollars? Mayfield said. The Department of Corrections would not answer questions about its stance on an ombudsman.

Losier, the professor who has studied prisons, said another key change to the grievance system should be more transparency. New York state, for example, issues yearly reports on what types of grievances are filed and how the department handles them. That allows the public and lawmakers to monitor whats happening inside. But Illinois issues no such report.

New Yorks Corrections Department also maintains a database that tracks staff involved in misconduct and abuse claims, so the department can look for patterns. But in Illinois, despite records showing staff misconduct is one of the largest issues for prisoners, the department doesnt track grievances by guard name.

Burke, the former warden, said that having that information, even internally, would be helpful. If we have, you know, 90% of our grievances are on one person, then we know that theres a problem there.

Pacholke, the former administrator for the Washington State Department of Corrections, agreed, saying data collection is critical. If youre not tracking it, the next thing you know, something really horrific or tragic can happen, he said.

Neither the Corrections Department nor AFSCME, the union that represents most front-line corrections staff, responded to questions about the potential of tracking complaints about correctional officers.

In Liebichs case, problems within the prison persisted.

In January 2018, after his lawsuit was settled, the staff decided to test him for drugs again, according to discipline records. When he couldnt provide a urine sample, officers sent him back to segregation.

They just went through this with me. They know I have these medical issues, Liebich said in an interview. They know I had a civil suit about it, and they turn around and they did the same thing to me again.

Liebich spent his days in a cramped cell. The prison allowed inmates to leave their cells for mental health groups. Liebich said sessions were held in the former execution area, from when Illinois had the death penalty.

You can literally feel the hairs on your arms and your neck stand up, Liebich said. He felt powerless.

In January 2019, Liebich filed a second lawsuit against the prison over retaliation. Later that year the state agreed to settle and paid him $25,000, but denied wrongdoing.

Today, he said he still has nightmares about his time inside segregation.

Its frightening to think that they can do this to us and get away with it, Liebich said, and theres nobody that we can really go to for help.

WBEZ and ProPublica are investigating oversight in Illinois prisons. Please get in touch with reporter Shannon Heffernan if you have something to share about:

Violence and safety inside Illinois prisons

Staff conduct and oversight

Prisoner discipline

Internal affairs operations

You can reach her via email: sheffernan@wbez.org or phone: 312-893-2937

Shannon Heffernan is a criminal justice reporter for WBEZ. Email Heffernan at sheffernan@wbez.org and follow her on Twitter at @shannon_h.

Claire Perlman and Alex Mierjeski contributed research and Agnel Philip contributed data reporting.

More:
From Roaches To Medical Emergencies, Illinois Inmates Say Theres Nobody That We Can Really Go To For Help - WBEZ

Read More...

Veterinary Medicine Market Research Report by Product, by Animal Type, by Mode of Delivery, by End-user – Global Forecast to 2025 – Cumulative Impact…

December 3rd, 2020 12:58 am

New York, Nov. 26, 2020 (GLOBE NEWSWIRE) -- Reportlinker.com announces the release of the report "Veterinary Medicine Market Research Report by Product, by Animal Type, by Mode of Delivery, by End-user - Global Forecast to 2025 - Cumulative Impact of COVID-19" - https://www.reportlinker.com/p05989784/?utm_source=GNW

The Global Veterinary Medicine Market is expected to grow from USD 22,772.55 Million in 2019 to USD 34,932.83 Million by the end of 2025 at a Compound Annual Growth Rate (CAGR) of 7.39%.

Market Segmentation & Coverage:This research report categorizes the Veterinary Medicine to forecast the revenues and analyze the trends in each of the following sub-markets:

Based on Product , the Veterinary Medicine Market studied across Biologics, Medicated Feed Additives, and Pharmaceuticals. The Biologics further studied across DNA Vaccines, Inactivated Vaccines, Live attenuated vaccines, Recombinant Vaccines, and Vaccine. The Pharmaceuticals further studied across Analgesics, Anti-infectives, Anti-inflammatory, and Parasiticides.

Based on Animal Type, the Veterinary Medicine Market studied across Companion and Production. The Companion further studied across Cats, Dogs, and Horses. The Production further studied across Cattle, Fish, Poultry, Sheep & Goats, and Swine.

Based on Mode of Delivery, the Veterinary Medicine Market studied across Oral and Parenteral.

Based on End-user, the Veterinary Medicine Market studied across Point-of-care testing/In-house testing, Reference Laboratories, and Veterinary Hospitals & Clinics.

Based on Geography, the Veterinary Medicine Market studied across Americas, Asia-Pacific, and Europe, Middle East & Africa. The Americas region surveyed across Argentina, Brazil, Canada, Mexico, and United States. The Asia-Pacific region surveyed across Australia, China, India, Indonesia, Japan, Malaysia, Philippines, South Korea, and Thailand. The Europe, Middle East & Africa region surveyed across France, Germany, Italy, Netherlands, Qatar, Russia, Saudi Arabia, South Africa, Spain, United Arab Emirates, and United Kingdom.

Company Usability Profiles:The report deeply explores the recent significant developments by the leading vendors and innovation profiles in the Global Veterinary Medicine Market including Bayer AG, Biognesis Bag S.A., Boehringer Ingelheim GmbH, Ceva Sant Animale, Company overview, Elanco, Financial Performance, Hester Biosciences Limited, Indian Immunologicals Limited, Kinderbio, Merck Animal Health, Neogen Corporation, Nutreco N.V., Product Benchmarking, Strategic Initiatives, Vetiquinol S.A., Virbac, and Zoetis.

FPNV Positioning Matrix:The FPNV Positioning Matrix evaluates and categorizes the vendors in the Veterinary Medicine Market on the basis of Business Strategy (Business Growth, Industry Coverage, Financial Viability, and Channel Support) and Product Satisfaction (Value for Money, Ease of Use, Product Features, and Customer Support) that aids businesses in better decision making and understanding the competitive landscape.

Competitive Strategic Window:The Competitive Strategic Window analyses the competitive landscape in terms of markets, applications, and geographies. The Competitive Strategic Window helps the vendor define an alignment or fit between their capabilities and opportunities for future growth prospects. During a forecast period, it defines the optimal or favorable fit for the vendors to adopt successive merger and acquisition strategies, geography expansion, research & development, and new product introduction strategies to execute further business expansion and growth.

Cumulative Impact of COVID-19:COVID-19 is an incomparable global public health emergency that has affected almost every industry, so for and, the long-term effects projected to impact the industry growth during the forecast period. Our ongoing research amplifies our research framework to ensure the inclusion of underlaying COVID-19 issues and potential paths forward. The report is delivering insights on COVID-19 considering the changes in consumer behavior and demand, purchasing patterns, re-routing of the supply chain, dynamics of current market forces, and the significant interventions of governments. The updated study provides insights, analysis, estimations, and forecast, considering the COVID-19 impact on the market.

The report provides insights on the following pointers:1. Market Penetration: Provides comprehensive information on the market offered by the key players2. Market Development: Provides in-depth information about lucrative emerging markets and analyzes the markets3. Market Diversification: Provides detailed information about new product launches, untapped geographies, recent developments, and investments4. Competitive Assessment & Intelligence: Provides an exhaustive assessment of market shares, strategies, products, and manufacturing capabilities of the leading players5. Product Development & Innovation: Provides intelligent insights on future technologies, R&D activities, and new product developments

The report answers questions such as:1. What is the market size and forecast of the Global Veterinary Medicine Market?2. What are the inhibiting factors and impact of COVID-19 shaping the Global Veterinary Medicine Market during the forecast period?3. Which are the products/segments/applications/areas to invest in over the forecast period in the Global Veterinary Medicine Market?4. What is the competitive strategic window for opportunities in the Global Veterinary Medicine Market?5. What are the technology trends and regulatory frameworks in the Global Veterinary Medicine Market?6. What are the modes and strategic moves considered suitable for entering the Global Veterinary Medicine Market?Read the full report: https://www.reportlinker.com/p05989784/?utm_source=GNW

About ReportlinkerReportLinker is an award-winning market research solution. Reportlinker finds and organizes the latest industry data so you get all the market research you need - instantly, in one place.

__________________________

See the original post here:
Veterinary Medicine Market Research Report by Product, by Animal Type, by Mode of Delivery, by End-user - Global Forecast to 2025 - Cumulative Impact...

Read More...

Veterinary Medicine Consumption Market Size, Analysis, Growth, Trends, Outlook And Forecast By 2027 – Khabar South Asia

December 3rd, 2020 12:58 am

New Jersey, United States: Market Research Intellect has added a new report to its huge database of research reports, entitled Veterinary Medicine Consumption Market Size and Forecast to 2027. The report offers a comprehensive assessment of the market including insights, historical data, facts, and industry-validated market data. It also covers the projections using appropriate approximations and methods.

Veterinary Medicine Consumption Market Overview

The Veterinary Medicine Consumption Market Report provides comprehensive data on market dynamics, market trends, product growth rate, and price. The Veterinary Medicine Consumption market report has various facts and statistics assuming the future predictions of the upcoming market participants. In addition, it offers business security taking into account sales, profit, market volume, demand and market supply ratio. The in-depth study provides vital information related to market growth, driving factors, major challenges, opportunities, and threats that will prove to be very helpful for market participants in making upcoming decisions.

Veterinary Medicine Consumption Market: Competitive Landscape

The Veterinary Medicine Consumption Market report consists of the Competitive Landscape section which provides a complete and in-depth analysis of current market trends, changing technologies, and enhancements that are of value to companies competing in the market. The report provides an overview of sales, demand, futuristic costs and data supply as well as a growth analysis in the forecast year. The key vendors in the market that are performing the analysis are also clearly presented in the report. Their development plans, their growth approaches, and their merger and acquisition plans are also identified. Information specific to a keyword in each of these regions is also provided. This report also discusses the submarkets of these regions and their growth prospects.

Prominent players operating in the market:

Veterinary Medicine Consumption Market Segmentation

The report contains the market size with 2019 as the base year and an annual forecast up to 2027 in terms of sales (in million USD). For the forecast period mentioned above, estimates for all segments including type and application have been presented on a regional basis. We implemented a combination of top-down and bottom-up approaches to market size and analyzed key regional markets, dynamics and trends for different applications.

Veterinary Medicine Consumption Market Segment by Type:

Veterinary Medicine Consumption Market Segment by Application:

Veterinary Medicine Consumption Market Regional overview:

In the report, experts analyze and forecast the Veterinary Medicine Consumption market on a global as well as regional level. Taking into account all aspects of the market in terms of regions, the focus of the report is on North America, Europe, Asia Pacific, the Middle East and Africa, and South America. The prevailing trends and various opportunities in these regions are studied that can convince the growth of the market in the forecast period 2020 to 2027.

Reasons to Buy the Veterinary Medicine Consumption Market Report:

Outlook analysis of the Veterinary Medicine Consumption market sector with current trends and SWOT analysis. This study evaluates the dynamics, competition, industrial strategies and strategies of the emerging countries. This report has a comprehensive guide that provides market insights and detailed data on each market segment Market growth factors and risks are presented. More precise information provision on the Veterinary Medicine Consumption market for different countries. Provide visions on factors influencing the growth of the market. Market segmentation analysis, including quantitative and qualitative research considering the impact of economic and non-economic aspects Comprehensive company profiles with product offerings, important financial information and the latest developments.

If you have any custom requirements, please let us know and we will offer you the customized report as per your requirements.

About Us:

Market Research Intellect provides syndicated and customized research reports to clients from various industries and organizations with the aim of delivering functional expertise. We provide reports for all industries including Energy, Technology, Manufacturing and Construction, Chemicals and Materials, Food and Beverage, and more. These reports deliver an in-depth study of the market with industry analysis, the market value for regions and countries, and trends that are pertinent to the industry.

Contact us:

Mr. Steven Fernandes

Market Research Intellect

New Jersey ( USA )

Tel: +1-650-781-4080

Website https://www.marketresearchintellect.com/

Here is the original post:
Veterinary Medicine Consumption Market Size, Analysis, Growth, Trends, Outlook And Forecast By 2027 - Khabar South Asia

Read More...

COVID-19 Pushes Telehealth for Veterinary Care Into the Spotlight – mHealthIntelligence.com

December 3rd, 2020 12:58 am

December 01, 2020 -One side-effect of the coronavirus pandemic is that it has highlighted new uses for telehealth. And veterinary care is at the top of that list.

Interest in veterinary telehealth is surging during the ongoing crisis, from pet owners looking for care without having to travel to veterinarians looking to expand their reach without filling their clinics and even to health plans and health systems who are identifying social and societal factors that affect ones health and wellness.

With intensifying concern around COVID-19, use of telemedicine has become an important way to protect and monitor the health of veterinary patients and veterinary teams, the American Veterinary Medical Association (AVMA) advises on its website. Using telemedicine can help prevent the spread of COVID-19, because it allows veterinary patients to be appropriately triaged and monitored with only those veterinary patients that really need to be seen making the trip to the clinic along with their owners.

The advantages of telehealth for veterinary care are similar in many aspects to human care. Pet owners would like access to virtual care so that their pet could be seen by a veterinarian without the hassle of time and money spent on travel and waiting in a waiting room, especially if the issue is minor and can be addressed via video consult or even a phone call. On the other side, a connected health platforms could give veterinarians access to a much wider patient population, allow them to connect with specialists and prescribe medications, and even monitor pets at home after discharge or for chronic care and medication management.

The bigger challenge lies in getting the payer industry interested in pet health, and that ties into growing evidence that pet health directly affects the health and welfare of pet owners.

READ MORE: Arizona Governor Loosens Restrictions on Telehealth for Veterinarians

Some 65 percent of Americans have a pet, says Mark Cushing, founding partner and CEO of the Animal Policy Group, and academic research has proven that pet ownership has a positive impact on health. In fact, many doctors would be willing to prescribe a pet as a means of addressing stress, loneliness or other health issues.

And pet owners are prepared to spend the same dollars on taking care of a dog or cat as themselves, their spouse or their children, Cushing said during a session on veterinary telehealth at this years virtual annual conference of the American Telemedicine Association.

In fact, pet ownership is inching into the sandbox of social determinants of health, that fast-growing concept favored by care providers and payers who want to address healthcare through not only clinical treatment but health and wellness factors.

Social determinants of health the various circumstances in which an individual is born and lives affects roughly 60 percent of patient health outcomes, well ahead of genetics (30 percent) and even clinical care (10 percent). This means that issues including income, education, transportation, lifestyle, housing and safety all have a strong impact on ones health.

Add to that list owning and caring for a pet, which ties directly into ones emotional well-being. In a survey conducted by Xtelligent Healthcare Media, the parent company to mHealthIntelligence, 11 percent of respondents identified pet ownership as aSDOH, 5 percent screen their patients for pet ownership, and 9 percent partner with organizations within the community to address the ups and downs of life with Fido or Mittens.

READ MORE: NJ Telemedicine Law Delayed By Concerns About Veterinarian Use

Prior to 2015, connected health platforms for veterinary care were pretty much non-existent, save for the odd mHealth app designed to help pet owners track their pets health and some platforms put to use by large farms and ranches to track herd health. Many states outlawed the use of telehealth for veterinary care, bowing to an industry that traditionally sees in-person (or in-pet) care as a significant source of income.

The COVID-19 crisis changed that thinking.

COVID has had a dramatic effect on veterinary care, Cushing said. Not only were people adopting pets in greater numbers to deal with isolation brought on by the pandemic, but veterinary care providers were looking for new ways to deliver care while reducing clinic visits. State governments, as well, recognized the impact, and many added veterinary care to the list of services covered by telehealth under emergency measures.

Telemedicine was the tool to use, he said.

In many cases we dont think the governors were aware that there were restrictions on pet telemedicine, Deb Leon, CEO of WhiskerDocs whose pet telehealth company saw a 30 percent surge in business due to COVID-19 said during the ATA session.

READ MORE: RAM Hands Management of Wise Mobile Health Clinic to The Health Wagon

Recognizing that interest, the US Food & Drug Administration issued its own guidance for telehealth use during the pandemic, suspending enforcement of certain rules around the dispensing of medications and the use of telemedicine to develop what is called the veterinary client-patient relationship (VCPR). That said, the FDA defers to state veterinary medical associations or boards of veterinary medicine for telehealth guidance.

Prior to COVID-19, only about 3 percent of the health insurance market covered pets (about half the health plans in Europe, meanwhile, cover pet health), and few payers were interested in extending those benefits. That made it difficult for telehealth to gain a foothold.

We dont have a healthcare funding mechanism for pets like we do for humans, so veterinary medicine for the most part is a cash business, Cushing noted. And that business was focused on getting people into the clinic for care.

But COVID-19 changed that, and veterinarians are now beginning to dabble in telehealth.

They werent sure how to do it, they werent sure if it was legal, (and) they werent sure if they could make any money off of it (or if) their staffs would even be comfortable with it, Cushing pointed out. They werent sure if their pet owners would even want it. the answer is yes.

Leon says pet owners want access to their pets medical record and the ability to get medications without having to travel to a clinic. They want on-demand care for their pets as they would for themselves or their family members.

This is really about providing pet owners with pet care on their terms, she said.

And about improving the health of the pet owners.

According to the Human Animal Bond Research Institute (HABRI), which studies the bond between humans and pets, 85 percent of practitioners surveyed agree that interaction with their pets helps reduce loneliness, and 76 percent say human-pet interactions can help reduce social isolation.

That can also affect workplace health at Sony, for instance, 40 percent of the workforce has children but 70 percent have pets. According to HABRI, almost three-quarters of pet owner surveyed would decline a job offer in favor of a pet-friendly workplace, and health plans that offer pet benefits see a 30 percent increase in employee engagement, a 10 percent to 20 percent boost in worker retention and improved presenteeism.

And while telehealth adoption is driven by younger generations demand access to care on their terms, that trend is playing out in the pet world as well. According to Cushing, 62 percent of all pets in America are owned by Millennials and Gen Z - and they want pet healthcare the same way they want their own healthcare, travel and commerce.

Even commercial pet companies are getting into the space. In October, mail-order pet care company Chewy launched its own Connect With a Vet telehealth service.

We have focused our efforts into developing an easy to use and convenient tele-triage product that we anticipate will have a positive impact given the current environment, and also extend beyond that, company CEO Sumit Singh said in a press release. We are always looking to enhance our customers experience. Visiting a local vet continues to be a challenge for many pet parents during this time. Similarly, the vet community has also been impacted via clinic shutdowns or reduced clinic hours. So, we thought, why not come up with a solution that can help both communities, our customers and veterinarians, in this time of greatest need.

The Florida-based company piloted its service in Florida and Massachusetts before expanding to more than 35 states. It partners with local veterinarians on the connected health platform, allowing them to bolster their business during the coronavirus pandemic.

Read more here:
COVID-19 Pushes Telehealth for Veterinary Care Into the Spotlight - mHealthIntelligence.com

Read More...

The Automation Evolution – Today’s Veterinary Business Magazine

December 3rd, 2020 12:58 am

The line between robotics and biological engineering is becoming blurred as advances overlap.

Imagine a pet owner enters a veterinarians office and is greeted by a 5-foot-tall robot that provides limited but flawless reception services. Given audible instructions, the client and his pet enter a designated exam room. There, a human veterinary nurse performs hands-on procedures like a dental exam and blood draw. She then activates another robot and leaves the room. This robot uses a voice interface and a touchscreen on its chest to collect a detailed medical history. The final portion of the visit is done by a remote televeterinarian who instructs the client to position the pet for the best camera view. The veterinary nurse is summoned to the exam room when needed. If special procedures or hospitalization are indicated, the pet is taken to a central room staffed by people using 3D video connected to anyone in the world.

Far-fetched? Not for long.

Humanitys fascination with robots is as old as the ancient world. In historical times, some kings tried to fool the uneducated by using bronze fortune-teller heads that gave prepared answers to questions. All the fake head did was offer the kings superstitious opinions. Today, talking machines are no longer a myth. Assistants like Siri, Alexa and Hey Google are becoming an essential part of our lives. Going even further, innovator Elon Musk revealed that Neuralink, one of his start-up companies, is creating a wireless, implantable brain-machine device designed to achieve human symbiosis using artificial intelligence (AI).

Modern medical robotics began with devices for human prosthetics, rehabilitation and disability assistance. They are now increasingly mechanized. Because many new technologies are routinely developed using animal subjects, the benefits are easily adopted into veterinary medicine once the models become affordable and more readily available.

Lets explore where things stand and the possibilities.

Human robotic surgeries began near the end of the 20th century as early prototypes were tested and upgraded. Developed by General Motors in the mid-1980s, the PUMA (Programmable Universal Machine for Assembly) was the first robotic surgical system. Despite its popularity, PUMA had a short lifespan due to liability issues. Later, surgical robots were fitted with smaller arms for precise incisions and injections, or in the case of IBMs Robodoc, for precise bone drilling during hip replacements. By 2000, the most notable breakthrough involved the Da Vinci minimally invasive surgical system, which has been part of over 6 million human surgical, laparoscopic and endoscopic procedures.

Meanwhile, the University of Pennsylvania School of Veterinary Medicine in 2011 opened the then-state-of-the-art Buerger Family Minimally Invasive Surgery Suite. PennVet stated, We are now outfitted with the same advanced technologies found in the worlds top human hospitals. The integrated operating room strives to connect the medical team, robots and the suite itself through voice control of temperature, humidity and more.

Many progressive veterinary professionals embrace One Health and the view that integrating human and animal care will speed our acceptance of robotic and AI technology. In 2006, the Association of American Veterinary Medical Colleges launched a task force to explore AI developments in the field of veterinary student education. Trying to envision the future, the task force report identified artificial intelligence as one of the most significant factors in the future of veterinary training and education.

What is increasingly obvious is that AI robots will become autonomous over time and evolve autonomously. Recently, the Smart Tissue Autonomous Robot (STAR) system, designed by Childrens National Hospital in Washington, D.C., outperformed several human surgeons in collecting pig heart valves for human transplants. Not only did STAR provide consistent results that exceeded human abilities, but it never tired of repeating the same procedure over and over. Although human doctors are needed to handle complications, most of the process is fully robotic.

Some thought leaders, like Musk and Microsoft co-founder Bill Gates, predict that machine artificial intelligence will eventually equal and then overtake full human intelligence. The crossover point has been dubbed The AI Singularity. A popular Netflix documentary, The Social Dilemma, makes the point that machines have surpassed human weaknesses in areas such as memory and calculation.

Therapy robopets, now sold as toys, are given to lonely, hospitalized children and convalescing seniors when live pets cannot be present. Robotic animals also can be found in veterinary continuing education. Used for simulation, robot dogs and cats provide lifelike test subjects for a variety of training exercises, from CPR scenarios to external clinical assessments. In 2010, the Cornell University College of Veterinary Medicine introduced Robo-Jerry the dog and Robo-Fluffy the cat. The inventor, Dr. Daniel Fletcher, who serves as chair of Cornells Educational Technology Steering Committee, is working on Butch, a more advanced model.

The line between robotics and biological engineering is becoming blurred as advances overlap. For example, robot bees are used in horticulture to boost lagging pollination rates. Other programs, like the National Oceanography Centre in Wales, have used marine robots to simulate life in the oceans depths. The cost and technical requirements of such machines have led some researchers to leave biomimicry behind and seek more organic alternatives.

Enter animal cyborgs.

From slugs to fish to mammals, live animals given implanted components provide an often cheaper, easier and more effective adoption of robotic technology. In one example, fish have been genetically engineered and equipped with sensors designed to flash colors when in contact with specific toxins. Remotely controlled rats can help with explosives investigations, vector control and disaster response. Researchers at Case Western Reserve University combined tissues from a sea slug and 3D printed materials to build biohybrid robots that crawl like crabs as they clean the beach.

We can expect an ongoing merger of AI and robotics. Although the idea frightens some people, this development likely will lead to a higher standard of veterinary care. Questions remain concerning the costs, ethics and commercialization.

Like it or not, machines are pushing us from one industrial revolution to the next. Only 20 years ago, who predicted broadband wireless internet, cloud computing and smartphones? Simply thinking of smartphones as AI robots will make the transition to the future less scary and more exciting. Veterinarians who pay attention will have front-row seats and help drive our professions technological evolution.

Innovation Station guest columnist Dr. Rolan Tripp is a veterinary futurist, certified animal behavior consultant and artificial intelligence software developer at Pet Happiness Network [pethappiness.net]. He is a graduate of the University of California, Davis, School of Veterinary Medicine, president-elect of the Society for Veterinary Medical Ethics and the founder of the Veterinary Future Society.

Follow this link:
The Automation Evolution - Today's Veterinary Business Magazine

Read More...

UConn, Mystic Aquarium Work Together to Enhance Animal Health – UConn Today

December 3rd, 2020 12:57 am

Visiting an aquarium transports people to another world: an underwater world filled with many different plants and animals. Connecticuts famous Mystic Aquarium cares for 5,000 animals from over 355 species, from octopuses to beluga whales to sea lions. Studying these animals offers a unique opportunity to learn about conserving these species in the wild, in support of the aquariums mission to care for and protect our ocean planet through conservation, education, and research.

Behind habitats that feature brightly-colored fish and a diversity of other animals, like beluga whales that appear to engage with visitors, are the professionals veterinarians, aquarists, trainers, divers, and environmental quality staff that protect the health, safety, and wellbeing of the animals. The Connecticut Veterinary Medical Diagnostic Laboratory (CVMDL) in the Department of Pathobiology and Veterinary Science at UConns College of Agriculture, Health and Natural Resources is a partner in protecting and enhancing the health of the aquatic animals at Mystic Aquarium, and has collaborated with its veterinarians for almost 30 years.

CVMDL partners with Mystic Aquarium on diagnostics and research to advance aquatic animal care and health, and shares these initiatives with the larger scientific and educational communities.

The partnership between CVMDL and Mystic Aquarium started with Dr. Salvatore Frasca Jr., the director of CVMDL. Frascas research focus is on pathology and diagnostics of aquatic animals. Service, through his appointment with UConn Extension and work with CVMDL, has always been a key component of his work.

I chose UConn because it was close to Mystic Aquarium, Frasca says. Im proud and pleased that CVMDL, through our service and educational activities, has been supporting Mystic Aquarium for over 30 years. We have a legacy of Extension activities at Mystic Aquarium that many people from both organizations have been part of.

Frasca was enrolled in the Residency/Ph.D. program in veterinary anatomic pathology at UConn in the 1990s after earning his veterinary degree from the University of Pennsylvania. Prior to that, he had worked closely with Dr. J. Lawrence Dunn, the veterinarian at Mystic Aquarium at the time. The two realized there was a nationwide shortage of educational opportunities for veterinarians to learn aquatic animal medicine. Together, they wrote a grant to create an internship program at Mystic Aquarium.

Mystic Aquariums Internship in Aquatic Animal Medicine and Research teaches veterinarians how to apply and develop their skills for the benefit of aquatic animals and helps veterinarians further develop their expertise with research. It was the first aquatic marine animal veterinary internship ever offered, and Mystic Aquariums internship program has since trained nearly 30 veterinarians, many of whom are now leaders in the field of aquatic animal medicine, including two of the veterinarians currently employed at Mystic Aquarium itself. After receiving the grant, Frasca was encouraged to apply, and served as the first veterinary intern in the program in 1992. For nearly thirty years the program has continued to train veterinarians in aquatic animal health and has prompted similar opportunities in other locations.

The idea of developing educational experiences in clinical medicine and pathology was the foundation of the original partnership. CVMDL provides the pathology component, and Mystic Aquarium has the clinical component. They are parallel tracks that weave back and forth because of the nature of the programs. Veterinarians come to UConns residency program in veterinary anatomic pathology, in part, because they want to gain experience with aquatic animals. CVMDL integrates aquatic animals into the fabric of the training material and provides transformational learning experiences.

Enhancing Animal Health and Conservation

Dr. Allison Tuttle is the Senior Vice President of Zoologic Operations at Mystic Aquarium. She was introduced to Mystic Aquarium on a tour with the AQUAVET program, and then served as the Veterinary Intern in Aquatic Animal Medicine and Research from 2002 to 2004. Tuttle re-joined the aquarium as Director of Animal Care in 2007, when Dunn retired. In her current role, Tuttle oversees animal husbandry, animal rescue, veterinary services, environmental quality, the dive program, and exhibit interpretation.

I fell in love with Mystic Aquarium on that initial tour, Tuttle says. There is a nice balance of opportunities among the programs we have, and we play a key role in wild marine animal rescue for our region.

Mystic Aquariums Animal Rescue Program manages 1,000 miles of coastline and monitors deceased wild marine mammals and sea turtles to determine their cause of death. The aquarium sends samples to CVMDL for histopathologic analysis, which provides critically important information on what is happening in our oceans. The aquarium submits reports containing this data to federal agencies, and these reports are utilized to shape regulations and policies preventing fisheries and human interaction, which is important for marine mammal and sea turtle conservation.

Our oceans are changing, and there are a lot of unusual mortality events, in particular with large whale species in the greater Atlantic region, Tuttle says. As new issues emerge with the ocean it becomes increasingly important to monitor what is occurring. Its tremendously difficult to study these whales; the data we collect is sometimes the only information we have on these animals.

CVMDLs pathology and diagnostic services have been integral to the health of Mystic Aquariums animals as well. They partner on sample analysis for their animals as well as on scientific collaborations. The aquarium sends samples to CVMDL for histopathologic analysis and biopsies on active clinical cases. The results from CVMDL are important in the management of a healthy, robust population, by informing treatment and allowing for the best animal care possible.

Scientific research is another area where Mystic Aquarium and CVMDL collaborate. Aquatic clinical medicine and pathology go hand-in-hand. For example, Mystic Aquarium worked with CVMDL and the Connecticut Agricultural Experiment Station to report Eastern Equine Encephalitis (EEE) infection in a colony of penguins in 2003. Until that report, EEE infection in penguins had not been described. They published their findings in the Journal of the American Veterinary Medical Association.

Mystic Aquarium has a great relationship with UConn and Dr. Frasca, says Tuttle. We have a strong connection with UConn, and our conservation and animal care are greatly enhanced through our partnership with CVMDL.

CVMDL is on the front lines of research and testing to keep humans and animals safe. The aquatic animal pathology service is one part of their work. Clients include those within the state, such as Mystic Aquarium and The Maritime Aquarium at Norwalk, and clients and aquariums from across the country. The laboratory offers diagnostic testing in support of pathology, including bacterial and fungal culture and molecular testing. The long-standing service history in aquatic animal pathology started with the relationship with Mystic Aquarium, and now serves a number of other aquariums nationwide.

CVMDL is committed to working with Mystic Aquarium, weve always known that Mystic Aquarium is a special asset for Connecticut, Frasca concludes. Extension activity is born of confluence and synergy of educational activities. That is exactly what happened with Mystic Aquarium.

Follow this link:
UConn, Mystic Aquarium Work Together to Enhance Animal Health - UConn Today

Read More...

Dr. Donald Faust Buckley, Lover Of Animals, Owned South Salem Animal Hospital For 22 Years – Putnam Daily Voice

December 3rd, 2020 12:57 am

Dr. Donald Faust Don Buckley, 93, of Winchester, VA and beloved father and abuelo, passed away at his home on Tuesday, Nov. 24 surrounded by his six children.

Dr. Buckley was born at home in Far Rockaway on Nov. 23, 1927. He was a longtime resident of North Salem and a parishioner at St. Josephs Church in Croton Falls.

Dr. Buckley entered the Cornell School of Veterinary Medicine at the age of 16. Upon completion of his degree, he entered veterinary practice in Newburgh. During the Korean War, he served as a practicing veterinarian in the U.S. Air Force.

After his service, he worked as a veterinarian in Buffalo before buying the South Salem Animal Hospital from which he retired in 1984 after 22 years of practice. Dr. Buckley was known for his compassionate care, love of animals and technical expertise.

In 1994 Don and his beloved wife Missy (predeceased) moved to Winchester, VA. Together they enjoyed volunteering, playing tennis, hiking and visiting with their grandchildren. Don was an accomplished potter and served as a past president of the Shenandoah Potters Guild.

He will be remembered as an exceptional listener and gentle soul and cherished for his kindness, wit and welcoming spirit.

Don is survived by his children: Kent (Julie), Kevin (Sheila), Steven (Sara), Teresa (Skip), John (Sue) and Mary Anne (Shawn); 10 grandchildren: Malena, Ian, Megan, Jacob, Nina, Colin, Griffin, Sean, Caroline and Jillian; and 5 great grandchildren: Meredith, Ethan, Adrian, Callie and Madison. His wife (Missy), parents (Harry and Myrtle) and sister (Anne) predeceased him in death.

A memorial service for Don will be held at a later date. Contributions can be made in his name to Blue Ridge Hospice.

Click here to sign up for Daily Voice's free daily emails and news alerts.

The rest is here:
Dr. Donald Faust Buckley, Lover Of Animals, Owned South Salem Animal Hospital For 22 Years - Putnam Daily Voice

Read More...

Five research teams selected for Catalyst for Innovative Partnership funding – Source

December 3rd, 2020 12:57 am

Five interdisciplinary teams of researchers from across Colorado State University have been selected by the Office of the Vice President for Research to form a third cohort for the Catalyst for Innovative Partnership funding program.

These teams were selected from a competitive pool of applicants to pursue significant issues in our society using research partnerships to create new opportunities and solutions.

The CIP program is a premier interdisciplinary program, providing significant resources to teams to empower them to pursue their passions and create new solutions for some of our most significant societal problems, said Alan Rudolph, CSUs vice president for research. Our office mobilizes significant resources in facilitating these teams to achieve their dreams, and we are proud of the results of the first two cohorts that have led to substantial outcomes.

Each team will receive seed funding of up to $200,000. The teams are provided infrastructure support by OVPR to nurture the creation and delivery of solutions. This includes exposure to translation and commercialization opportunities, partnering within the team and disciplines, and partnerships external to the University.

The financial returns from these teams are significant, but the impacts far exceed these outcomes for our institution, said Rudolph.

OVPR launched the CIP program in 2015, investing over $2 million in the first two cohorts, which has yielded over $23 million in research awards by these teams.

Building on the launch of the Columbine Health System Center for Healthy Aging, this team will explore new correlations in aging in dogs as key models for age-related human cognitive decline. They will compareaging in cells in companion animals and people to study the correlations and mechanisms of human aging and diseases.

This team is led by Karyn Hamilton, professor of health and exercise science and director of the Translational Research on Aging and Chronic Disease Laboratory.

CSU is well positioned to contribute to solutions to the climate change threats that face our society. This team will explore soil-based solutions as a critical carbon dioxide greenhouse gas removal technology and improve sustainable food, fiber and bioenergy production, and environmental health.

This team is led by Keith Paustian, University Distinguished Professor in the Department of Soil and Crop Sciences and senior research scientist at the Natural Resource Ecology Laboratory.

The recent COVID-19 pandemic reminds us of the complexity of diseases that can rapidly move in our society. C4MInD represents the first academic effort that targets the connection and roles between metabolism and infectious disease. The mission of C4MInD is to enable the development of new treatments, preventions, and diagnostics for infectious diseases by resolving host-vector-pathogen-environment interactions at a metabolic level.

This team is led by John Belisle, professor of microbiology, immunology and pathology and director of the Rocky Mountain Regional Center of Excellence for Biodefense and Emerging Infectious Disease Research.

CSUs OVPR has invested in the expansion of augmented and virtual reality with impacts in translation into new applications. The VetVR virtual reality team will extend this impact by providing unique virtual training tools to be integrated into the teaching curriculum for remote, hands-on veterinary training to educate animal care professionals. Students, veterinarians, nurses and technicians will use this virtual training program to practice veterinary medicine.

This team is led by Pedro Boscan, professor of clinical sciences and anesthesiologist at the James L. Voss Veterinary Teaching Hospital.

One of the biggest societal challenges we face is integrating our ever-expanding scientific knowledge into new policies that can create impact and change. This team will address this challenge and actively coordinate research and policy outreach to address climate changes grand challenge.

They will examine how social and ecological systems can successfully adapt in the face of climate change and pursue unique fundraising and research opportunities to help train researchers in federal and state policy outreach.

This team is led by Courtney Schultz, associate professor of forest and rangeland stewardship and director of the Public Lands Policy Group.

The OVPR is excited to embark with these teams on their journeys of discovery and look forward to the many impacts they will make in the future, said Rudolph.

The rest is here:
Five research teams selected for Catalyst for Innovative Partnership funding - Source

Read More...

HOLIDAY HELPING: Toy Drives and Pet Baskets – UC Davis

December 3rd, 2020 12:57 am

2,304 pounds of food, delivered!

Mail Services recently wrapped up its 16th annual Holiday Food Drive on the Davis and Sacramento campuses, collecting a total of 2,304 pounds of nonperishable food for people in need.

Here are the numbers: 1,509 pounds of food gathered in outgoing mail at UC Davis Health and 795 pounds dropped off to Mail Services at the Hopkins Services Complex in Davis.

Like all good mail personnel, the UC Davis team part of supply Chain Management made sure the food got delivered, despite some pandemic-related logistical challenges.

In years past, Mail Services donated food from UC Davis Health to Sacramento Food Bank & Family Services and food from the Davis campus to the Yolo County Food Bank. This year, because of operational and staffing issues, both organizations initially turned down the food donations.

So, Mail Services staff members identified two other recipients: the Rose Family Creative Empowerment Center in Sacramento and the ASUCD Pantry.

However, on Nov. 20, as Mail Services personnel at UC Davis Health prepared to deliver the food, they were informed that the Rose Family Creative Empowerment Center would not be able to accept the donation after all. Fortunately, by then, Sacramento Food Bank & Family Services had the staff and volunteers necessary to process the donations.

In the end, Mail Services made its deliveries to Sacramento Food Bank & Family Services and The Pantry, benefiting students in need.

Toys for Tots on the Davis campus Mail Services announced that it has moved up the deadline to this Friday (Dec. 4) at the request of the Marine Corps Reserve, which runs Toys for Tots in Yolo County. Mail Services handles the campus collection annually on behalf of the reserve, which asks for new and unwrapped toys for Yolo County children up to age 16. There are three ways to donate on campus:

UC Davis Childrens Hospital Virtual Holiday Toy Drive Donations are welcome on two platforms through Dec. 24:

We invite the community to join us in making the holidays brighter for our patients and families, as this year has brought unique difficulties, said Diana Sundberg, manager of the UC Davis Child Life and Creative Arts Therapy Department.

We know this season will look very different, she said. We hope that our virtual toy drive will make it easy and safe for people to give. The support of the community means so much to us.

Mercer Clinic Holiday Pet Baskets, given to homeless people for their pets, will soon be distributed for the 26th consecutive year, thanks to volunteer elves who share an affiliation with the UC Davis Veterinary Medical Teaching Hospital. And the elves have issued their annual fundraising appeal to keep the project going.

It began in 1995, organized by hospital staff members for the benefit of homeless people and their pets who visited the Mercer Clinic for the Pets of the Homeless, another project with UC Davis volunteers: students and veterinarians from the School of Veterinary Medicine, and pre-veterinary undergraduates. The clinic is in Sacramento, on the grounds of the charity organization Loaves & Fishes where the Holiday Pet Baskets are distributed.

The holiday program still has most of its original volunteers even those who have retired from the hospital and newer staff members have joined in.

The pandemic has limited the volunteers ability to gather for basket-decorating, so this years goodies will come in bags adorned with the Mercer Clinic logo, according to VMTH retiree Eileen Samitz, who serves as co-coordinator with Becky Griffey, a VMTH employee.

The distribution will comprise 130 bags in all 100 for dogs and 30 for cats holding toys, treats and brushes, typical of what has been given since the first year of the program.

The distribution also will include pet coats and sweaters something the elves added to the program in 2012, offering protection from rain and cold when pets are spending winter days and nights outdoors with their people.

Donations to the Mercer Clinic Holiday Pet Baskets and Winter Pet Coat and Sweater Program are tax-deductible and can be made as follows:

For more information, contact co-coordinator Samitz by email or phone, 530-756-5165.

Organized by Unitrans and the Davis Food Co-op, this fourth annual event will be held from 9:30 a.m. to 4 p.m. Saturday, Dec. 12, in the parking lot of Davis Food Co-op, 620 G St.

Stuff the Bus this year is more than a food drive. Donations will go to the ASUCD Pantry, which assists students in need and has specifically asked fornew shampoo, conditioner, body wash and bars of soap.

The Pantry also provided a list of suggested food donations: canned or boxed meals; gluten-free grains like quinoa and buckwheat; canned fruit and vegetables; canned or dry beans; canned soup; low-sugar cereal; rice; whole grain pasta and please dont forget the peanut butter and similar items.

The bus to be stuffed is not just any bus its a Davis transportation icon, a Unitrans vintage London double-decker that has not been on the road since the pandemic struck in March. People are welcome to climb the stairs to the buss upper deck a treat for all ages.

Each of the first 50 donors will receive a Unitrans pass good for 10 free rides.For donors convenience, the Davis Food Co-op will offer prepacked bags of groceries and other items at the checkout stands bags you can buy to help Stuff the Bus.

Follow Dateline UC Davis on Twitter.

Continue reading here:
HOLIDAY HELPING: Toy Drives and Pet Baskets - UC Davis

Read More...

Veterinary Medicine Market Research 2020: Global Opportunities, Sales Revenue, Key Players Analysis and Industry Growth with CAGR of Forecast by 2026…

December 3rd, 2020 12:57 am

The latest market study, titledGlobal Veterinary Medicine Market Report 2020 by Key Players, Types, Applications, Countries, Market Size, Forecast to 2026 (Based on 2020 COVID-19 Worldwide Spread), has been featured onKandJMarketResearch.comoffers a perceptive assume the historical data of the market and forecasts time-period. The report provides an understanding of the global Veterinary Medicine industry competitors, the sales channel, growth potential, market trends, industry product innovations and the volume of size, market segments, and market share of the best performers or products.

Present market trends and dynamics are evaluated which helps in planning the way of the global market. A chapter-wise arrangement has been used to comfort the readability and complexity of the data. Each chapter is more categorized into its particular segments covering well-structured data.

Get Sample Copy of the Report (After COVID-19 Impact):Click Here ->http://www.kandjmarketresearch.com/sample-request/546242

The segmentation plays a prominent role in dealing with the growth of the Veterinary Medicine market where variousVeterinary Medicine Industrytypes and applications are promoting a better understanding of the market. This segmentation has a strong foundation in volume-wise and value-wise data which backs the process of understanding the market scenario with numbers. The market has been explored properly to get all the factors in line. TheVeterinary Medicinereport has been enriched interviews as a first-hand method of getting data. These interviews include chats with top market players, market analysts, distributors, people in the field of research and development, and others owing to which the reliability of the report has increased significantly.

Some of the prominent players operating in the global Veterinary Medicine market are Bayer Healthcare AG, Virbac S.A, Merck & Co., Inc. (Intervet), Vetoquinol SA, Ceva Sant Animale, Boehringer Ingelheim GmbH, Sanofi S.A. (MERIAL Limited), Nutreco N.V., Eli Lilly and Company (Elanco/Novartis), Zoetis, Inc. (Pfizer)

Veterinary Medicine Market Segmentation by Type:Biologics, Pharmaceuticals, Medicated Feed Additives

Buy 1-user Veterinary Medicine market Report with post-pandemic era analysis Click Here ->http://www.kandjmarketresearch.com/buyreport/cart?report_id=546242

Veterinary Medicine Market Segmentation by Application:Reference Laboratories, Point-of-care testing/In-house testing, Veterinary Hospitals & Clinics, OthersRegional market analysis of the report has backed the study of different regions as an attempt to understand growth pockets that can be beneficial for the market. The regional analysis has import, export, and other processes covered. Players who are getting involved in the market for better growth are looking for these growth pockets to capitalize on the opportunities provided and find new scopes for growth. Certain countries have been tracked in detail to monitor them closely as they can be major markets in the coming years. Benefits like better infrastructure, cost-effective labor, access to raw materials, they offer have become luring factors for many market players and they want to expand their business to these regions to increase their profit margin.

Reasons to Buy the Report:1.In an insight outlook, this research report has dedicated to several quantities of analysis industry research (global industry trends) and Veterinary Medicine market share analysis of high players, along with company profiles, and which collectively include about the fundamental opinions regarding the market landscape, emerging and high-growth sections of Veterinary Medicine market, high-growth regions, and market drivers, restraints, and also market chances.2.The analysis covers the Veterinary Medicine market and its advancements across different industry verticals as well as regions. It targets estimating the current market size and growth potential of the global Veterinary Medicine Market across sections such as also application and representatives.3.Additionally, the analysis also has a comprehensive review of the crucial players on the Veterinary Medicine market together side their company profiles, SWOT analysis, latest advancements, and business plans.

Ask Discount for this Premium Report @www.kandjmarketresearch.com/discount/546242

Geographically, the Report on Global Veterinary Medicine is divided intoNorth America (United States, Canada, Mexico), Europe (Germany, UK, France, Italy, Spain, Russia, Others), Asia-Pacific (China, Japan, South Korea, Australia, India, Southeast Asia, Others), Middle East and Africa (Saudi Arabia, UAE, Egypt, Nigeria, South Africa, Others), South America (Brazil, Argentina, Columbia, Chile and Others)

Customization of the Report :If you have any special requirements for the report or customized report on separate regional or country-level, please connect with our sales team[emailprotected], who will ensure that you will get a report that suits your needs. You can also get in touch with our executives on+1-661-636-6162to share your research requirements.

About Us :Kandjmarketresearch.com is part of theKnowledgeNJournals Research Firmwhich provides premium progressive market research reports, statistical surveying, analysis & forecast data for industries and governments from hundreds of publishers around the world. We have almost all top publishers reports in our collection to provide you with instant online access to the worlds most complete and fresh database on a Daily Basis. We are at KandJ Market Research are inspired to help our clients grow by providing appropriate business insight with our huge market intelligence source.

For more details, contact at:Yash KandJ Market Research(Part of KnowledgeNJournals Research)USA:+1 (661) 636 6162 |IND:+91 9325802062Email:[emailprotected];Web:www.kandjmarketresearch.com

Originally posted here:
Veterinary Medicine Market Research 2020: Global Opportunities, Sales Revenue, Key Players Analysis and Industry Growth with CAGR of Forecast by 2026...

Read More...

Treating cancers starts small: More than 100 Purdue scientists study cancer on the cellular level – Purdue News Service

December 3rd, 2020 12:57 am

Drug discovery at heart of Purdue University Center for Cancer Research findings, mission

WEST LAFAYETTE, Ind. When cancer patients ask about the drug that may save their lives, they dont expect to hear about zebrafish or fruit flies. Yet this is precisely where the life-saving treatments coming out of the Purdue University Center for Cancer Research begin.

As one of only seven basic laboratory cancer centers recognized by the National Cancer Institute, which is part of the National Institutes of Health, PCCR connects more than 110 researchers from across the university to study cancer on the cellular level. This form of molecular research is the foundation of all drug discovery.

We study normal cell function in very basic systems like yeast, fruit flies and zebrafish, said Timothy L. Ratliff, the Robert Wallace Miller Director of the PCCR. Theyre simple models that help us define pathways quite rapidly and effectively.

The center, which celebrated its 40th year as an NCI-recognized member in 2018,has recently received a five-year accreditation extension as part of the competitive renewal of its NCI basic laboratory cancer center status.

The work in PCCRs labs advances understandings of cancer prevention, detection, diagnosis and treatment.

Though they may never see a human patient, PCCR researchers do treat naturally occurring cancer in canines. As the only NCI basic laboratory cancer center that includes a college of veterinary medicine, PCCR has the unique opportunity to study canine oncology while giving dogs chances to live longer, fuller lives.

We actually treat canine cancers, Ratliff said. Pet owners are ecstatic that we can extend the lives of their pets, and we utilize this process to better understand cancer in people.

Work by Deborah Knapp, the Dolores L. McCall Professor of Comparative Oncology in Purdues College of Veterinary Medicine and 2017 Purdue Research Foundation Innovator Hall of Fame inductee, has recognized bladder cancer in dogs as the most relevant model for invasive bladder cancer in humans. By treating canine patients, Purdues researchers can observe therapies in clinical settings comparable to human circumstances.

PCCR also advances technologies in cancer detection, imaging and treatment thanks to the universitys roster of experts in engineering and related fields. Engineering and physics methods allow the production of tools that improve effectiveness of cancer-related drugs. One example is a branch of biodynamic imaging technology in development by PCCR member David Nolte, the Edward M. Purcell Distinguished Professor of Physics and Astronomy. The developments improve treatment by detecting a patients sensitivity to chemotherapeutic drugs.

Other innovations allow cancer researchers to better understand the cellular changes that happen in tumor formation. PCCR member Bumsoo Han, a professor of mechanical engineering, worked alongside Stephen Konieczny, now a professor emeritus of biological sciences, to develop a pancreatic cancer time machine to observe how cells with key gene mutation interact and become invasive. The tumor model also can be used as a prescreening tool to discover new drug targets for better drugs.

Collaborations such as these are unusual for academic institutions.

Only MIT [Massachusetts Institute of Technology] has a similar marriage with engineering, Ratliff said.

PCCR researchers also work diligently to move discoveries out of the lab and into public use in conjunction with the Purdue Institute for Drug Discovery. Because investigating the safety and efficacy of drugs is an expensive, time-consuming process, Ratliff co-founded the Boilermaker Health Innovations, a certified nonprofit that helps fund Purdue-discovered drugs through human clinical trials. Compounds that make it through a Phase I trial can often be sold to an established pharmaceutical manufacturer or spun off into a for-profit company.

One of the centers most recognized success stories is Endocyte Inc., a startup originating from the work of PCCR member Philip S. Low, co-founder of the Boilermaker Health Innovations, the Presidential Scholar in Drug Discovery and the Ralph C. Corley Distinguished Professor of Chemistry. Lows research, which focuses on providing direct-targeted treatment to diseased cells through the creation of small molecules, helped the biopharmaceutical company reach its $2.2 billion value. PCCR was instrumental in advancing a key targeting molecule by initiating a Phase 0 clinical trial that had such positive results it was a critical drug that contributed significantly to the sale of Endocyte Inc., Ratliff said.

Below are some examples of PCCR scientists and stories about their work.

Graham Cooks, the Henry B. Hass Distinguished Professor of Analytical Chemistry

Mark S. Cushman, Distinguished Professor of Medicinal Chemistry

Deborah Knapp, the Dolores L. McCall Professor of Comparative Oncology

Sophie A. Lelivre, professor of cancer pharmacology

Philip S. Low, the Ralph C. Corley Distinguished Professor of Chemistry, Presidential Scholar in Drug Discovery

Ei-ichi Negishi, 2010 Nobel Prize in chemistry, the Herbert C. Brown Distinguished Professor of Organic Chemistryw and the Teijin Limited Director of the Negishi-Brown Institute

Herman O. Sintim, the Drug Discovery Professor of Chemistry in Purdues Department of Chemistry

About Purdue University

Purdue University is a top public research institution developing practical solutions to todays toughest challenges. Ranked the No. 5 Most Innovative University in the United States by U.S. News & World Report, Purdue delivers world-changing research and out-of-this-world discovery. Committed to hands-on and online, real-world learning, Purdue offers a transformative education to all. Committed to affordability and accessibility, Purdue has frozen tuition and most fees at 2012-13 levels, enabling more students than ever to graduate debt-free. See how Purdue never stops in the persistent pursuit of the next giant leap athttps://purdue.edu/.

Writer: Christy McCarter

Media contact: Amy Patterson Neubert, apatterson@purdue.edu

Source: Timothy L. Ratliff, tlratliff@purdue.edu

Journalists visiting campus: Journalists should followProtect Purdue protocolsandthe followingguidelines:

View original post here:
Treating cancers starts small: More than 100 Purdue scientists study cancer on the cellular level - Purdue News Service

Read More...

Husker Horse Judging Team reins in success amid pandemic – Fence Post

December 3rd, 2020 12:57 am

LINCOLN, Neb. The University of Nebraska Lincoln Horse Judging Team galloped through the season, reining in much success despite the current pandemic.

Coach Kathy Anderson said that over the past few years, the team has not always had enough students to compete as a full team of five. The addition of Brooke Parrish, a graduate student and assistant coach, has been a huge asset, Anderson said. Parrish has focused on recruiting team members and increasing competition participation.

Though the COVID-19 pandemic has interrupted many facets of competition, Anderson said this team maintained its grit. Competitions continued, abiding by the guidelines of social distancing.

Still, with the cancellation of the All American Quarter Horse Congress in October due to COVID-19, there was going to be a long gap between competitions. Students could have easily become bored. However, Parrishs creativity kept the teams spirits up. She arranged a mock horse judging contest at the universitys R.B. Warren Arena that even drew a group from Cloud County Community College in Concordia, Kan. The event gave students a chance to gain feedback in a contest setting.

The hands-on opportunity and practice yielded the team success at the National Reining Horse Association and American Quarter Horse Association World Show contests. The team placed eighth overall at the NHRA contest. In the World Show contest, the team earned fourth overall and fourth in performance. In the open division, Kathlyn Hauxwell, a senior animal science and pre-veterinary medicine major from McCook, placed third in performance and fifth overall. Hannah Wiese, a junior elementary education major from Papillion, placed 17th in performance. Ali Klapal, a freshman animal science and pre-veterinary medicine major from Omaha, was 19th in halter. Alyssa Waits, a senior animal science major from Tryon, received third in performance, third in halter, sixth in reasons and third overall in the limited division.

Other team members include: Jenna Glidden, a sophomore animal science and pre-veterinary medicine major from Valley; Claire Goetschkes, a sophomore animal science and pre-veterinary medicine major from Bellevue; Kristianna Muller, a junior veterinary science and pre-veterinary medicine major from Papillion; and Payton Schiller, a freshman animal science and pre-veterinary medicine major from Scribner.

Wiese was able to hone her reason-giving skills this season.

The motivation to do better and try harder really motivated me, she said. I was trying my best to be a good role model.

The best thing Ive gotten out of it is the relationships that Ive built with my teammates. And being on the trips, we meet a lot of different trainers or people in the industry, so thats cool.

Anderson said her favorite part is seeing students grow and evolve, especially when they realize how much theyve learned and the impact being a part of the team has had on them. And shes thankful to the College of Agricultural Sciences and Natural Resources for even making the season possible.

We appreciate the support and everything, particularly through this tough year, of being able to travel and go because I know it was hard and it wasnt normal, she said.

See original here:
Husker Horse Judging Team reins in success amid pandemic - Fence Post

Read More...

Horse judging team reins in success amid pandemic – Nebraska Today

December 3rd, 2020 12:57 am

The University of NebraskaLincoln Horse Judging Team galloped through the season, reining in much success despite the currentpandemic.

Coach Kathy Anderson said that over the past few years, the team has not always had enough students to compete as a full team of five. The addition of Brooke Parrish, a graduate student and assistant coach, has been a huge asset, Anderson said. Parrish has focused on recruiting team members and increasing competitionparticipation.

Though the COVID-19 pandemic has interrupted many facets of competition, Anderson said this team maintained its grit. Competitions continued, abiding by the guidelines of socialdistancing.

Still, with the cancellation of the All American Quarter Horse Congress in October due to COVID-19, there was going to be a long gap between competitions. Students could have easily become bored. However, Parrishs creativity kept the teams spirits up. She arranged a mock horse judging contest at the universitys R.B. Warren Arena that even drew a group from Cloud County Community College in Concordia, Kansas. The event gave students a chance to gain feedback in a contestsetting.

The hands-on opportunity and practice yielded the team success at the National Reining Horse Association and American Quarter Horse Association World contests. The team placed eighth overall at the NHRA contest. In the World contest, the team earned fourth overall and fourth in performance. In the open division, Kathlyn Hauxwell, a senior animal science and pre-veterinary medicine major from McCook, placed third in performance and fifth overall. Hannah Wiese, a junior elementary education major from Papillion, placed 17th in performance. Ali Klapal, a freshman animal science and pre-veterinary medicine major from Omaha, was 19th in halter. Alyssa Waits, a senior animal science major from Tryon, received third in performance, third in halter, sixth in reasons and third overall in the limiteddivision.

Other team members include: Jenna Glidden, a sophomore animal science and pre-veterinary medicine major from Valley; Claire Goetschkes, a sophomore animal science and pre-veterinary medicine major from Bellevue; Kristianna Muller, a junior veterinary science and pre-veterinary medicine major from Papillion; and Payton Schiller, a freshman animal science and pre-veterinary medicine major fromScribner.

Wiese was able to hone her reason-giving skills thisseason.

The motivation to do better and try harder really motivated me, she said. I was trying my best to be a good rolemodel.

The best thing Ive gotten out of it is the relationships that Ive built with my teammates. And being on the trips, we meet a lot of different trainers or people in the industry, so thatscool.

Anderson said her favorite part is seeing students grow and evolve, especially when they realize how much theyve learned and the impact being a part of the team has had on them. And shes thankful to the College of Agricultural Sciences and Natural Resources for even making the seasonpossible.

We appreciate the support and everything, particularly through this tough year, of being able to travel and go because I know it was hard and it wasnt normal, shesaid.

Read the rest here:
Horse judging team reins in success amid pandemic - Nebraska Today

Read More...

Veterinary Medicine Market Research, Size, Share Analysis by Manufacturers, Regions, Type and Application to 2026 – The Market Feed

December 3rd, 2020 12:57 am

The research study of the global Veterinary Medicine market provides the market size information and market trends along with the factors and parameters impacting it in both the short and long term. The report ensures a 360-degree assessment, bringing out the complete key insights of the industry. These insights help the business decision-makers to make better business plans and informed decisions for the future business. In addition, the study helps the venture capitalist in understanding the companies better and take informed decisions.

The Veterinary Medicine market research report provides essential statistics on the market position of the Veterinary Medicine manufacturers and is a valuable source of guidance and direction for companies and individuals interested in the industry. The report provides a basic summary of theVeterinary Medicine industry including its definition, applications and manufacturing technology. The report presents the company profile, product specifications, capacity, production value, and market shares for key vendors.

The overall market is split by the company, by country, and by application/type for the competitive landscape analysis. The report estimates market development trends of Veterinary Medicine industry. Analysis of upstream raw materials, downstream demand and current market dynamics is also carried out. The Veterinary Medicine market report makes some important proposals for a new project of Veterinary Medicine Industry before evaluating its feasibility.

Request for a sample copy of the report to get extensive insights into Veterinary Medicine market @https://www.in4research.com/sample-request/1771

Key segments covered in Veterinary Medicine market report: Major key companies, product type segment, end use/application segment and geography segment.

The information for each competitor includes:

Company segment, the report includes global key players of Veterinary Medicine as well as some small players:

For product type segment, this report listed the main product type of Veterinary Medicine market

For end use/application segment, this report focuses on the status and outlook for key applications. End users are also listed.

Any Questions/Queries or need help? Speak with our analyst:https://www.in4research.com/speak-to-analyst/1771

This report covers the following regions:

Key Questions Answered in the Report:

We also can offer a customized report to fulfill the special requirements of our clients. Regional and Countries report can be provided as well.

Ask for more details or request custom reports from our industry experts @https://www.in4research.com/customization/1771

Continue reading here:
Veterinary Medicine Market Research, Size, Share Analysis by Manufacturers, Regions, Type and Application to 2026 - The Market Feed

Read More...

Page 325«..1020..324325326327..330340..»


2025 © StemCell Therapy is proudly powered by WordPress
Entries (RSS) Comments (RSS) | Violinesth by Patrick